MAE_06010 gene from Microcystis aeruginosa NIES-843 and MiAbW_01735 gene from Microcystis aeruginosa NIES-4325 were optimized according to the codon usage in E. coli and synthesized by GENEWIZ (Suzhou, China). The chaperone plasmids set (pG-KJE8, pGro7, pKJE7, pG-Tf2, pTf16) was from Takara Bio Inc. (Dalian, China). EasyPfu DNA polymerase, T4 DNA ligase, DNA marker, Fast Mutagenesis System and FlyCut endonucleases were obtained from TransGen Biotech (Beijing, China). SSADH was purified by our laboratory [35 (link),36 (link)]. The gene names used in this study were adopted from CyanoOmicsDB (http://www.cyanoomics.cn/lz/index , accessed on 25 September 2022) [22 (link)]. All other chemicals were purchased from Solarbio (Beijing, China) with the highest purity unless otherwise specified.
Pg tf2
Manufactured by Takara Bio
Sourced in China, Japan
The PG-Tf2 is a lab equipment product offered by Takara Bio. It is a device designed for the purification of proteins. The core function of the PG-Tf2 is to separate and concentrate specific proteins from complex biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Pgro7, by Takara Bio (3 mentions)
Pg kje8, by Takara Bio (3 mentions)
Pkje7, by Takara Bio (2 mentions)
Pcold 1 vector, by Takara Bio (2 mentions)
Fast mutagenesis system, by Transgene (1 mentions)
T4 dna ligase, by Transgene (1 mentions)
Easypfu dna polymerase, by Transgene (1 mentions)
Dna marker, by Transgene (1 mentions)
His select nickel affinity gel, by Merck Group (1 mentions)
Glutathione sepharose 4b, by GE Healthcare (1 mentions)
Gel band purification kit, by GE Healthcare (1 mentions)
Gfxtm pcr dna, by GE Healthcare (1 mentions)
Ptf16, by Takara Bio (1 mentions)
Ni nta superflow, by Qiagen (1 mentions)
Protease inhibitor cocktail, by Merck Group (1 mentions)
8 protocols using pg tf2
1
Optimized Microcystis Genes in E. coli
2
Ligand Binding Assay for RAR LBD
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PcauRAR LBD−His6-tagged trigger factor hybrid protein was expressed in Escherichia coli BL21 (DE3) cells containing the chaperon plasmid pG-Tf2 (Takara bio, Kusatsu, Shiga, Japan) and purified by using His-select nickel affinity gel (Sigma−Aldrich, St. Louis, MO, USA). The HsaRARα LBD-Glutathione S-transferase hybrid protein was expressed in Escherichia coli BL21 (DE3) cells and purified by Glutathione Sepharose 4B (GE Healthcare, Chicago, IL, USA) (positive control). Ligand binding assay was assessed as previously described [22 (link),46 (link),47 (link),48 (link)]. In brief, the purified protein (12.5 μg/mL) was incubated with 10 nM of all-trans retinoic acid (11, 12-3H) ([3H] ATRA; 1.665 TBq/mmol; Amersham Biosciences) or 10 nM of Retinoic Acid, (11, 12-3H) 9-cis ([3H] 9cisRA; 1.95 TBq/mmol; PerkinElmer). Unlabeled ATRA and 9cisRA were used to compete for [3H] ATRA or [3H] 9cisRA in this assay to determine the binding preferences of PcauRAR LBD or HsaRARα LBD. Hydroxyapatite was added to precipitate the receptor protein and bound radioactive compounds after an incubation step at 4 °C for 1 h. The hydroxyapatite pellet was washed. The radioactivity in the pellet was determined by liquid scintillation counting.
3
Recombinant Protein Expression in E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
E. coli DH5α and E. coli BL21(DE3), used for plasmid propagation and over-expression, respectively, were purchased from Novagen (Madison, WI, USA). pET24b(+) was obtained from Novagen (Madison, WI, USA) and was used as a cloning and expression vector. pET24bPsBFDC and pET19bPsBADH containing benzoylformate decarboxylase gene (dpgB) and benzaldehyde dehydrogenase gene (dpgC) of Pseudomonas stutzeri ST201, respectively, were obtained from our previous study [15 (link)], and also pEPL containing d -phenylglycine aminotransferase gene (dpgA) was obtained from our previous study [20 (link)]. Chaperone plasmids pG-KJE8, pGro7, pKJE7, pG-Tf2, and pTf16 were purchased from Takara Bio Inc. (Shiga, Japan). GFXTM PCR DNA and Gel Band Purification Kit were products of GE Healthcare Inc. (Buckinghamshire, UK). Different strains of E. coli were cultivated at 37 °C in Luria Bertani (LB) medium (Difco, Tucker, GA, USA).
4
Recombinant Flavoprotein Expression in E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For expression in E. coli, a 568-bp fragment encoding the complete sequence of the fldP gene was obtained by PCR amplification, using p2-fldP as template, and primers Rec-FldP-F and Rec-FldP-R, which contain restriction sites for NdeI and HindIII, respectively (Table S2 ). The amplified fragment was digested with the corresponding enzymes, cloned into compatible sites of pET-TEV (Novagen) under the control of the T7 promoter, and fused in-frame to an N-terminal His-tag. To improve solubility, BL21 E. coli cells were co-transformed with this vector and plasmid pG-Tf2 (Takara Bio Inc) expressing E. coli molecular chaperones (GroEL, GroES and Trigger Factor). After induction with 0.2 mM isopropyl-β-D-thiogalactoside (IPTG), the soluble flavoprotein was purified from cleared lysates in a Ni-NTA column by elution with 500 mM imidazole. Expression and purification of IsiB were carried out according to Fillat et al.[20] (link). UV-visible spectra of the purified recombinant proteins and FMN were recorded in 50 mM Tris-HCl pH 8.5.
5
Recombinant Human eIF2 Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human eIF2, codon optimized for Escherichia coli, was cloned into a pET28a expression vector. This plasmid was cotransformed with the chaperone plasmid pG-Tf2 (Takara Bio) and, for phosphorylated eIF2, an additional plasmid expressing PERK kinase domain. eIF2α was purified by sequential nickel-affinity, cation-exchange, and size-exclusion chromatography. Details are included in SI Appendix .
6
Heterologous Expression of Txtd and Txte
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
E. coli DH5α was used for molecular cloning and plasmid propagation. E. coli BL21 Star(DE3) was used for preparation of cell extracts. The genes of txtD (1203 bp) and txtE (1221 bp) were amplified by PCR from the genome of Streptomyces acidiscabies and cloned into the vector pJL1. The primers used for PCR amplification are shown in Table 1 . Plasmid pJL1-sfGFP was digested with NdeI and SalI to obtain a linearized backbone, which was ligated with the genes txtD and txtE, respectively, using a recombinant ligation kit (Beyotime, China). The resulting plasmids for cell-free expression were named as pJL1-TxtD and pJL1-TxtE. The plasmids of molecular chaperones (pG-KJE8, pGro7, and pG-Tf2) were obtained from TaKaRa (Beijing, China). pG-KJE8 (dnaK-dnaJ-grpE and groES-groEL), pGro7 (groES-groEL), and pG-Tf2 (groES-groEL-tig) were transformed into of E. coli BL21 Star(DE3), respectively, for the preparation of cell extracts containing chaperone proteins.Table 1
Primers used for PCR amplification.
| Genes | Primer sequences (5’→3′) |
|---|---|
| txtD | |
| Forward | catcatcatcaccatatgacctccgaagtcgctctgggccctt |
| Reverse | tgttagcagccggtcgacttactggtgggggtagaagttggggcgct |
| txtE | |
| Forward | catcatcatcaccatatgaccgtcccctcgccgctcgccga |
| Reverse | tgttagcagccggtcgacttagcggaggctgagcggcaggga |
7
Recombinant Enzyme Expression and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The coding sequences of TAA1/TARs or YUC enzymes were amplified from cDNA by PCR using the primers shown in SI Appendix, Table S1 . The PCR products were introduced into the pCold I vector (Takara) and transformed into E. coli SoluBL21 cells (Genlantis), in which the chaperone vector pG-Tf2 (Takara) had been introduced. Expression and purification of the recombinant enzymes were performed as described previously (18 ).
8
Recombinant Protein Expression and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA fragment containing the entire reading frame of Os05g0406100 was amplified by RT-PCR using specific primers (SI Appendix, Table S2 ), followed by ligation into the XbaI/XhoI site of the pCOLD I vector (Takara Bio). The BL21 (DE3) strain harboring pG-Tf2 (Takara Bio) was used as the E. coli host. Protein expression was induced in modified M9 medium (9 (link)) for 20 h at 15 °C. Crude soluble proteins were extracted from the BL21 cells by sonication in extraction buffer (50 mM NaH2PO4-NaOH pH8.0, 300 mM NaCl, 10 mM imidazole, 1 mM MgCl2, 5 mM β-mercaptoethanol) containing a protease inhibitor cocktail (P8849, SIGMA). The recombinant proteins were purified by nickel affinity chromatography using Ni-NTA Superflow (QIAGEN) according to the manufacturer’s instructions. Purified recombinant proteins were stored at −80 °C in the presence of 15% (w/w) glycerol.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!