For cell experiments, the plasmid based siRNA targeting for XIST and XIST overexpression vector were purchased from Shanghai Genepharma Co., Ltd. siRNA-XIST: 5′-AATGGAACGGGCTGAGTTTTAG-3′. MiR-93-5p mimics, miR-93-5p inhibitor and miRNA control were purchased from RiboBio Co., Ltd., Guangzhou, China. Briefly, 100 nM of MiR-93-5p mimics or miR-93-5p inhibitor or 1000 ng plasmid were transfected with each 6-well plate for 48 h using Lipofectamine 2000 (Invitrogen, Waltham, MA, USA). For animal experiments, cells were stably transfected with XIST based on lentiviral, constructed by Hanyin Biotechnology Co., Ltd., Shanghai, China. After transfection, the DMEM was replaced with DMEM supplemented with puromycin (3 μg/ml) for excluding non-infected cells. Then, the selected cell were used in the subcutaneous xenograft.
Control mirna
Manufactured by RiboBio
Sourced in China
Control miRNA is a synthetic, non-coding RNA molecule that serves as a reference standard for the quantification and normalization of microRNA (miRNA) expression levels in various experimental settings. It is designed to mimic the characteristics of naturally occurring miRNA sequences, providing a reliable control for accurate data analysis and interpretation.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (4 mentions)
Dual luciferase reporter assay system kit, by Promega (2 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions)
Control sirna, by RiboBio (2 mentions)
Mimics, by Thermo Fisher Scientific (1 mentions)
Mir 93 5p mimic, by RiboBio (1 mentions)
Mir 93 5p inhibitor, by RiboBio (1 mentions)
Mir 122 5p mimic, by RiboBio (1 mentions)
Mir 122 5p inhibitor, by RiboBio (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
Modulus single tube multimode reader, by Promega (1 mentions)
Pmirglo, by RiboBio (1 mentions)
Pmirglo, by Promega (1 mentions)
Lipofectaminetm 3000 kit, by Thermo Fisher Scientific (1 mentions)
Si nc, by RiboBio (1 mentions)
Mir 125b mimic, by RiboBio (1 mentions)
Stat3 sirna, by RiboBio (1 mentions)
E coli poly a polymerase, by New England Biolabs (1 mentions)
10 protocols using control mirna
1
XIST-mediated Regulation of miR-93-5p in Cancer
2
Modulating miR-122 Expression in Cervical Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Overexpression plasmids, short hairpin RNA (shRNA) control, miRNA control, miR‐122‐5p mimics (5′‐UGGAGUGACAAUGGUGUUUG‐3′) and miR‐122‐5p inhibitor (5′‐CAAACACCAUUGUCACACUCCA‐3′) were purchased from RiboBio (Guangzhou, China). The construct of the plasmid that included CDC25A 3′ UTR was purchased from RiboBio. Human cervical cancer cell lines (HeLa, HeLa229, C‐33A, CaSki, ME180 and SiHa) and normal cervical epithelial cells (END1/E6E7) were purchased from Shanghai Kanglang Biotechnology Co., Ltd. Shanghai, China. All cells were cultured in RPMI 1640 medium (Gibco, Grand Island, NY, USA), containing 10% FBS (Gibco) and 1% double antibody (penicillin/streptomycin; Gibco, Thermo Fisher Scientific, Waltham, MA, USA) at 5% CO2, 37 °C.
3
Evaluating MEG3 and miR-147 Interaction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To assay the interaction between MEG3 and miR-147, wide type 3′-UTR region of MEG3 and the mutant 3′-UTR of MEG3 were cloned into the firefly luciferase gene reporter vector pmiRGLO (Promega, Madison, WI, USA). The plasmid was synthesized by Invitrogen. The pmiRGLO-MEG3 or pmiRGLO-MEG3-MUT was co-transfected with miR-147 mimics or miRNA control (RiboBio, Guangzhou, China) into the 293 cells. The luciferase assays were performed using the dual-luciferase reporter assay system kit (Promega) according to the manufacturer's instructions. The luciferase expression was analyzed by Modulus single-tube multimode reader (Promega). The relative luciferase expression equaled the expression of the Renilla luciferase divided by the expression of the firefly luciferase. All the assays were repeated for at least 3 times.
4
Transfection of miR-31-5p Mimics and Inhibitors in NP Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We applied miR-31-5pmimic, miR-31-5p inhibitor, non-targeting siRNA control (si-NC) and miRNA control (RiboBio Inc., Guangzhou, China) according to the instructions of the LipofectamineTM 3000 kit (Invitrogen, Carlsbad, CA, United States) transfected into Cy3 labeled or unlabeled NP cells.
5
miR-125b Expression Analysis in Skin Conditions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from HaCaT cells, cholesteatoma, and the corresponding skin with RNAiso plus (TaKaRa Biotechnology Co. Ltd., Dalian, China). The integrity, purity, and concentration of total RNA were analysed by spectrophotometry and gel electrophoresis. Then, the RNA was polyadenylated using E. coli Poly (A) Polymerase (New England Biolabs, MA) and reverse-transcribed into cDNA with a PrimeScriptTM RT reagent Kit with gDNA Eraser (TaKaRa). Finally, quantitative real-time PCR was carried out using a SYBR®Premix Ex Taq™II (TaKaRa) and 7500 real-time PCR system (Applied Biosystems, USA). The relative expression of gene levels was calculated using the 2–ΔΔCT method. U6 served as an internal control normalised the expression data of miR-125b. The sequences of the primers: miR-125b-5p: 5’-TCCCTGAGACCCTAACTTGTGA-3’ miR-reverse: n5’-GCTGTCAACGATACGCTACG-3’; miR-RT primer: 5’-GCTGTCAACGATACGCTACGTAACGGCATGACAGTGTTTTTTTTTTTTTTTTTTTTTTT-3’; U6 forward: 5’-CTCGCTTCGGCAGCACA-3’ and reverse: 5’-AACGCTTCACGAATTTGCGT-3’; HaCaT cells were transiently transfected with miR-125b mimics, miR-125b inhibitor, control miRNA, STAT3 siRNA, and control siRNA (all from RiboBio Co. Ltd., Guangzhou, China), using Lipofectamine® 3000 reagent (Invitrogen, Carlsbad, CA, USA).
6
Biotinylated tRF-1020 mRNA Pulldown Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 3′‐end biotinylated tRF‐1020 or control miRNA (RiboBio, 50 nM) were transfected into HRVECs for 12 h. The biotin‐coupled RNA complex was obtained by incubating cell lysates with the streptavidin‐coated magnetic beads (Life Technologies). The amount of DVL mRNA or GAPDH mRNA in the bound fraction was determined by qRT‐PCR assay.
7
miRNA-Luciferase Reporter Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full sequence or 3′-untranslated region (3′UTR) of the gene was obtained by PCR amplification and cloned separately into the multiple cloning site of the psi-CHECKTM−2 luciferase miRNA expression reporter vector. 293T cells were transfected with an miRNA mimic, miRNA inhibitor, control miRNA, control miRNA inhibitor, or empty plasmid (50 nM; RiboBio, Guangzhou, China) using Lipofectamine 2000 according to the manufacturer's instructions. Nucleotide-substitution mutation analysis was carried out using direct oligomer synthesis of the full sequences or 3′UTR. All constructs were verified by sequencing. Luciferase activity was measured using a Dual Luciferase Reporter Assay System Kit (Promega, Madison, WI) on a Tecan M200 luminescence reader according to the manufacturer's instructions (7 (link)).
8
Evaluating miR-27a-3p Modulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The miR-27a-3p inhibitor and a negative control inhibitor (NC inhibitor), the miR-27a-3p mimic and control miRNA were purchased from RiboBio Co., Ltd. (Guangzhou, China). Cell transfection was performed using the Lipofectamine 2000TM reagent (Invitrogen, Thermo Fisher Scientific, Inc., Waltham, MA, USA) following the manufacturer’s instructions. Cells were harvested for further analysis after cultured for 48 h.
9
Transfection of Tumor Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transfection of AMC-HN-8 and Tu-212 cells was performed using Lipofectamine 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.). miR-375-3p mimic (5′-UUUGUUCGUUCGGCUCGCGUGA-3′), miR-375-3p inhibitor (5′-UCACGCGAGCCGAACGAACAAA-3′) and control miRNA (5′-GGUUCGUACGUACACUGUUCA-3′) were obtained from the Guangzhou RiboBio Co., Ltd. 50 nm of miRNA was diluted with 100 µl OPTI-MEM (Invitrogen; Thermo Fisher Scientific, Inc.) and subsequently incubated with 5 µl Lipofectamine 2000 for 15 min at room temperature. Subsequent experimentation was performed 48 h post-transfection.
10
Immortalized Keratinocyte Culture and Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An experimental line of human immortalized keratinocytes (HaCaT) was obtained from the Dermatology Key Laboratory of China Medical University. Cells were cultured in high-glucose Dulbecco's Modified Eagle Media (DMEM) (HyClone, Thermo Fisher, Beijing, China) with 10% fetal bovine serum (FBS) (Corning, Thermo Fisher, Waltham, MA). HaCaT cells were grown under sterile, humidified conditions at 37℃ and 5% CO2. The miR-203a inhibitor, control miRNA, Bmi1 small interfering (si)RNA, and control siRNA were synthesized by RiboBio (Guangzhou, China). They were transiently transfected into cells using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA), according to the manufacturer's instructions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!