After cells had undergone 24-h pre-treatment with various CoQ0 concentrations (0.5–2 μM), they were harvested. Subsequently, TRIzol reagent (Invitrogen, Carlsbad) was employed to extract total RNA. Then, Bio-Rad iCycler PCR instrument (Bio-Rad, Hercules, CA, United States) and SuperScript-III One Step RT-PCR platinum taq kit (Invitrogen, Carlsbad) were used for RT-PCR of 1 μg of total RNA in accordance with the procedure [28 ]. The PCR product was analyzed in agarose gel (1%). The primers used were as follows: MMP-2 F: 5′ATGACAGCTGCACCACTGAG-3′, R-5′-ATTTGTTGCCCAGGAAAGTG -3′; MMP-9 F-5′- TTGACAGCGACAAGAAGTGG-3′, R-5′-GCCATTCACGTCGTCCTTAT-3′; uPA F-5′-TGCGTCCTGGTCGTGAGCGA-3′, R-5′-CAAGCGTGTCAGCGCTGTAG-3′; uPAR F-5′CATGCAGTGTAAGACCCAACGGGGA-3′, R-5′-AATAGGTGACAGCCCGGCCAGAGT3′; E-cadherin: F-5′-TGGGTTATTCCTCCCATCAG-3′, R-5′TTTGTCAGGGAGCTCAGGAT-3′; Vimentin: F- 5′CTCTTCCAAACTTTTCCTCC 3′, R-5′AGTTTCGTTGATAACCTGTC 3′; Snail: F-5′CGAAAGGCCTTCAACTGCAAAT 3′, R-5′ACTGGTACTTCTTGACATCTG 3′; Slug: F- 5′CGCCTCCAAAAAGCCAAAC 3′, R-5′CGGTAGTCCACACAGTGATG 3′; β-catenin: F-5′-AAGGAAGCTTCCAGACATGC 3′, R-5′AGCTTGCTCTCTTGATTGCC 3′; 18S F-5′GTCTGTGATGCCCTTAGATG 3′, R-5′AGCTTATGACCCGCACTTAC 3′.
Icycler pcr instrument
Manufactured by Bio-Rad
Sourced in United States
The iCycler PCR instrument is a thermal cycler designed for performing polymerase chain reaction (PCR) experiments. It provides accurate temperature control and precise cycling for DNA amplification. The iCycler is capable of running standard PCR protocols and can be used for a variety of real-time PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Superscript 3 one step rt pcr platinum taq kit, by Thermo Fisher Scientific (3 mentions)
Rnase free dnase 1, by Qiagen (2 mentions)
Iq sybr green supermix, by Bio-Rad (2 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Qx200 droplet reader, by Bio-Rad (1 mentions)
Ddpcr supermix for probe no dutp, by Bio-Rad (1 mentions)
Quantasoft software, by Bio-Rad (1 mentions)
Qx200 droplet digital pcr system, by Bio-Rad (1 mentions)
Superscript 3 reverse, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Lightcycler 480 2, by Roche (1 mentions)
Beacon designer software, by Bio-Rad (1 mentions)
Tri reagent, by Merck Group (1 mentions)
High capacity cdna archive kit, by Thermo Fisher Scientific (1 mentions)
8 protocols using icycler pcr instrument
1
Quantifying Gene Expression Changes with CoQ0
2
Nrf2 Expression in Ectoine-Treated HaCaT Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ectoine pre-treated (1.5 μM, 24 h) HaCaT cells were subjected to the TRIzol reagent (Invitrogen, Carlsbad) for the isolation of total RNA from these cells. 1 µg of total RNA and the reagents supplied by the SuperScript-III One-Step RT-PCR platinum Taq kit (Invitrogen, Carlsbad) were used in the PCR experiment with the Bio-Rad iCycler PCR instrument (Bio-Rad, Hercules, CA, United States). The forward and reverse primers for Nrf2 used were: F: 5′-AAACCAGTGGATCTGCCAAC-3′, R-5′-GCAATGAAGACTGGGCTCTC-3′. The forward and reverse primers for GAPDH used were: F: 5′-GCATCCTGGGCTACACTGA-3′, R: 5′-CCACCACCCTGTTGCTGTA-3′. At the end of the experiment, PCR product was analyzed using 1% agarose gel. Then, it was visualized with ethidium bromide staining. As an internal control, we used GAPDH [22 (link)].
3
Measuring β-catenin Expression in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were seeded at a density of 4 × 106 cells/dish in 6 cm dish. After reaching 90% confluence, cells were incubated with CoQ0 (10 μM) for various time points (0.5-18 h). Total RNA from cultured cells was prepared using the TRIzol reagent (Invitrogen, Grand Island, NY). A 1 μg sample of total RNA was subjected to RT-PCR using a BioRad iCycler PCR instrument (Bio-Rad, Hercules, CA) and the SuperScript-III® One-Step RT-PCR Platinum taq® Kit (Invitrogen); amplification was performed in 30-38 cycles at 94°C for 45s (denaturing), 60-65°C for 45s (annealing), and 72°C for 1 min (primer extension). The sequences of the primers used in this study were as follows; β-catenin forward: 5′-TTACCTTCCCGAACATCGAC-3′, reverse: 5′-GCATAAATTCCCACTGCCAC-3′. The PCR products were electrophoresed in a 1% agarose gel and stained with ethidium bromide.
4
Retinal Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Retina was immersed in 350 μl TRIzol reagent (Invitrogen). Total RNA was isolated and treated with RNase-free DNase I (Qiagen) according to the manufacturer’s protocol. RNA was reverse transcribed into cDNA using SuperScript III reverse transcriptase (Invitrogen). Polymerase chain reaction (PCR) was performed using an iCycler PCR instrument (Bio-Rad) and LightCycler 480 II real-time PCR (RT-PCR) (Roche Applied Science). The gene-specific primers for cDNA sequences were listed in Table S1 . The thermal cycle was preincubation at 95 °C for 10 min followed by 45 cycles with denaturation at 95 °C for 15 sec, annealing/extension temperature at 60 °C for 1 min. All samples were run in triplicate. The threshold cycle value of the target gene (CTtarget) was corrected with that of the internal control gene β-actin (CTβ-actin). The expression values in each gene [2−(CTtarget-CTβ-actin)] were normalized. Fold changes resulting from treatment were obtained by comparing the normalized expression values for each gene in the treatment group and in the non-induced water treatment group.
5
Droplet Digital PCR for SARS-CoV-2 Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ddPCRs were performed on the QX200 Droplet Digital PCR system according to the manufacturer's instructions (Bio‐Rad). Briefly, reaction mixture consisted in 10 μl ddPCR Supermix for probe no dUTP (1863023, Bio‐Rad), 0.25‐1 ng of cDNA, primers and probes for E/IP4 and N/nsp13 duplex reactions used at concentration listed in Appendix Table S2 in a final volume of 20 μl. PCR amplification was conducted in a iCycler PCR instrument (Bio‐Rad) with the following condition: 95°C for 10 min, 40 cycles of 94°C for 30 s with a ramping of 2°/s, 59°C for 1 min with a ramping of 2°/s, followed by 98°C for 5 min with a ramping of 2°/s and a hold at 4°C. After amplification, the 96‐well plate was loaded onto the QX200 droplet reader (Bio‐Rad) that measures automatically the fluorescence intensity in individual droplets. Generated data were subsequently analyzed with QuantaSoft™ software (Bio‐Rad) based on positive and negative droplet populations. Data are expressed as CPD (copy per droplets) normalized to γ‐actin and Hprt reference gene relative expression.
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Twenty-five microliters of a PCR mixture, containing cDNA template equivalent to 80 ng of total RNA and 5 pmoles each of the forward and reverse primers and 2 × iQ™ SYBR® Green SuperMix (Bio-Rad, Hercules, CA, USA), were amplified using an iCycler PCR instrument (Bio-Rad, Hercules, CA, USA) to test for BMP-4, BMP-7, TGF-β2, Interleukin (IL)-1β and Osteocalcin (OC) or glyceraldehyde phosphate dehydrogenase (GAPDH, housekeeping gene). The PCR conditions were an initial melt at 95 °C for 3 min, followed by 45 cycles at 95 °C for 40 s, at 52 °C for 40 s, and at 72 °C for 40 s. Each sample was tested six times and the threshold cycle (Ct) values were averaged from each reaction. The fold change was defined as the relative expression compared to that at time 0, calculated as 2−∆∆Ct, where ∆Ct = Ctsample − CtGAPDH and ∆∆Ct = ∆Ctsample − ∆Cttime 0. All results were expressed in the Figures as ratio on control taken as 1.
Biomolecular analysis was performed at the Department of Clinical and Biological Sciences.
Biomolecular analysis was performed at the Department of Clinical and Biological Sciences.
7
Gene Expression Analysis via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were lysed in Trizol (Thermo Fisher, Cat# 15596026) on ice for 5 min. Total RNA was extracted and treated with RNase-free DNase I (Qiagen, Cat# 79256) according to the manufacturer's instructions. 1.5 μg RNA of each sample was reverse transcribed into cDNA by using SuperScript III reverse transcriptase (Thermo Fisher, Cat# 18080044) in an iCycler PCR instrument (Bio-Rad). The cDNA products were further used to measure the gene expression by a LightCycler 480 II real-time PCR instrument (Roche Applied Science). Gene expression was calculated using the 2−ΔΔCt method, and ACTB transcription levels were utilized as an internal control [36 (link)]. Sequences of specific primers for each detected gene are listed in Table 1 .
8
Quantifying PPARα mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PPARα mRNA content was examined in A427cells treated (sample) or not (control) with PUFAs for 24 hours.
Total RNA was extracted by using the TRI reagent (Sigma-Aldrich, St. Louis, MO, USA). Realtime PCR was performed with single-stranded cDNA prepared from total RNA (1 µg) using a High-Capacity cDNA Archive kit (Applied Bio Systems, Foster City, CA).
The forward and reverse primers were designed using Beacon Designer® software (Bio-Rad, Hercules, CA). Twenty-five microliters of a PCR mixture containing cDNA template equivalent 40 ng of total RNA, 5 pmoles each of forward and reverse primers, and 2× IQ SYBR Green SuperMix (Bio-Rad, Hercules, CA) were amplified using an iCycler PCR instrument (Bio-Rad, Hercules, CA) with an initial denaturation at 95°C for 3 min, followed by 35-40 cycles at 95°C for 30 s, annealing at 52°C for 40 s, extension at 72°C for 40 s. Each sample was tested in duplicate, and threshold cycle (Ct) values were averaged from each reaction. The change in expression was defined as that detected in the A427 cells treated with PUFAs versus that detected in the control cells, calculated as 2 -∆∆Ct , where ∆Ct = Ct sample -Ct GAPDH and ∆∆Ct = ∆Ct sample -∆Ct control .
Total RNA was extracted by using the TRI reagent (Sigma-Aldrich, St. Louis, MO, USA). Realtime PCR was performed with single-stranded cDNA prepared from total RNA (1 µg) using a High-Capacity cDNA Archive kit (Applied Bio Systems, Foster City, CA).
The forward and reverse primers were designed using Beacon Designer® software (Bio-Rad, Hercules, CA). Twenty-five microliters of a PCR mixture containing cDNA template equivalent 40 ng of total RNA, 5 pmoles each of forward and reverse primers, and 2× IQ SYBR Green SuperMix (Bio-Rad, Hercules, CA) were amplified using an iCycler PCR instrument (Bio-Rad, Hercules, CA) with an initial denaturation at 95°C for 3 min, followed by 35-40 cycles at 95°C for 30 s, annealing at 52°C for 40 s, extension at 72°C for 40 s. Each sample was tested in duplicate, and threshold cycle (Ct) values were averaged from each reaction. The change in expression was defined as that detected in the A427 cells treated with PUFAs versus that detected in the control cells, calculated as 2 -∆∆Ct , where ∆Ct = Ct sample -Ct GAPDH and ∆∆Ct = ∆Ct sample -∆Ct control .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!