Icrf 193

Manufactured by Santa Cruz Biotechnology

ICRF-193 is a laboratory reagent that functions as a catalytic inhibitor of topoisomerase II. It is commonly used in scientific research to study the role of topoisomerase II in cellular processes.

Automatically generated - may contain errors

Lab products found in correlation

5 protocols using icrf 193

Live-cell Imaging of Topoisomerase Inhibitors

Check if the same lab product or an alternative is used in the 5 most similar protocols

For live-cell imaging, cells were grown on 35-mm ibiTreat µ-dishes (Ibidi). Time-lapse Z-stack images were captured on a Nikon TiE microscope equipped with a 60× phase-contrast objective, 1.4-NA, Perfect Focus mechanism, Yokogawa CSU-W1 spinning disk, and Flash 4.0 sCMOS camera. Cells were imaged in the regular growth medium; 37°C and 5% CO₂ was maintained using an environmental control chamber (Okolab). 10 µM ICRF-193 (Santa Cruz Biotechnology) and 500 µM dexrazoxane (TCI America) were added shortly before initiation of imaging. Images were acquired with NIS Elements software. Image processing (maximum-intensity projection, background subtraction, and stack combining) was done in Fiji.

Potapova T.A., Unruh J.R., Yu Z., Rancati G., Li H., Stampfer M.R, & Gerton J.L. (2019). Superresolution microscopy reveals linkages between ribosomal DNA on heterologous chromosomes. The Journal of Cell Biology, 218(8), 2492-2513.

+ Open protocol

+ Expand

Manipulating Chromatin Structure and DNA Replication

Check if the same lab product or an alternative is used in the 5 most similar protocols

For inhibiting DNA replication, 50–100 µM APH (Wako; 011-09811) and 5–15 µM p27 recombinant protein were simultaneously added to the extracts with demembranated sperm chromatin. Geminin recombinant protein (0.4–1.2 µM) was added into the CSF extract and preincubated for 15 min at 22°C, in advance of adding CaCl₂, cycloheximide, and demembranated sperm chromatin. Both recombinant proteins were kindly gifted by Atsuya Nishiyama (University of Tokyo). For manipulating the chromatin structure, 5−20 mM MgCl₂, 10 µg/ml actinomycin D (Wako; 018-21264), or 141 µM ICRF-193 (Santa Cruz; sc-200889) was added to the extract containing preassembled nuclei after 30–40 min of incubation. For digesting DNA inside the nucleus, 0.2 U/µl EcoRI, 0.2 U/µl XhoI, or 0.1 U/µl HaeIII (NEB; R3101, R3101, R0146) was added with the equipped buffer (NEB; 1× CutSmart buffer) into the extract containing preassembled nuclei.

Heijo H., Shimogama S., Nakano S., Miyata A., Iwao Y, & Hara Y. (2020). DNA content contributes to nuclear size control in Xenopus laevis. Molecular Biology of the Cell, 31(24), 2703-2717.

+ Open protocol

+ Expand

Comprehensive Chemotherapeutic Reagent Procurement

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following reagents were purchased from Sigma: MG-132, chlorambucil, cyclophosphamide, carmustine, busulfan, dacarbazine, thiotepa, cisplatin, 5-fluorouracil, 6-mercaptopurine, gemcitabine, methotrexate, doxorubicin, epirubicin, actinomycin-D, mitomycin-C, topotecan, irinotecan, etoposide, mitoxantrone, paclitaxel, docetaxel, and vincristine. The following reagents were purchased from Calbiochem: carboplatin, pentostatin, and daunorubicin. The following reagents were purchased from Santa Cruz: ICRF-187, ICRF-193, and teniposide. The following reagents were purchased from MBL International Corporation: Z-VAD-FMK.

Hsu J.M., Xia W., Hsu Y.H., Chan L.C., Yu W.H., Cha J.H., Chen C.T., Liao H.W., Kuo C.W., Khoo K.H., Hsu J.L., Li C.W., Lim S.O., Chang S.S., Chen Y.C., Ren G.X, & Hung M.C. (2018). STT3-dependent PD-L1 accumulation on cancer stem cells promotes immune evasion. Nature Communications, 9, 1908.

+ Open protocol

+ Expand

Cell Cycle Regulation Assay Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Where indicated, cells were incubated in 1 μM ICRF193 (Santa Cruz), 1 μM Okadaic acid (Santa Cruz) or 2 μM AZ3146 (Tocris) for 5 min or 10 μM S-trityl-L-cysteine (Sigma) for 20 minutes (Figure 2E, F) or 2h (Figure S3C) before imaging. For RNAi, cells were transfected with 50 nM ON-TARGET plus siRNAs (Dharmacon) targeting RAD21 (AUACCUUCUUGCAGACUGUUU), KIF18A (GCCAAUUCUUCGUAGUUUU), Ska1 (pool targeting: GGACUUACUCGUUAUGUUA, UCAAUGGUGUUCCUUCGUA, UAUAGUGGAAGCUGACAUA and CCGCUUAACCUAUAAUCAA), or a nontargeting control using Lipofectamine RNAi MAX (Invitrogen) following instructions of the manufacturer. Plasmids containing wild type cyclin B1-mCherry or the non-degradable mutant (R42A and L45A) (Gavet and Pines, 2010 (link); Vazquez-Novelle et al., 2014 (link)) were transfected into HeLa cells using Fugene HD (Promega) according to manufacturer’s instructions 24 hours prior to imaging.

Su K.C., Barry Z., Schweizer N., Maiato H., Bathe M, & Cheeseman I.M. (2016). A Regulatory Switch Alters Chromosome Motions at the Metaphase to Anaphase Transition. Cell reports, 17(7), 1728-1738.

+ Open protocol

+ Expand

Cell Cycle Regulation Assay Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Su K.C., Barry Z., Schweizer N., Maiato H., Bathe M, & Cheeseman I.M. (2016). A Regulatory Switch Alters Chromosome Motions at the Metaphase to Anaphase Transition. Cell reports, 17(7), 1728-1738.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!