Quantitative real-time polymerase chain reaction (qRT-PCR) was used to detect the mRNA level of pro-inflammatory cytokines. Briefly, after cells were treated with PBS, IL-1β, or IL-1β+Salidroside, total RNA was extracted from the treated cells after 6 h with TRIzol (Invitrogen, Carlsbad, USA). The complementary DNA (cDNA) synthesis was conducted with an M-MLV Reverse Transcriptase kit (ELK Biotechnology). Quantitative PCR was performed on StepOne™ real-time PCR. The mRNA level was calculated using the 2–dd Ct method. The sequences of primers for qRT-PCR were as follows:
M mlv reverse transcriptase kit
Manufactured by Elk Biotechnology
Sourced in China
The M-MLV Reverse Transcriptase kit is a laboratory instrument used for the conversion of RNA into complementary DNA (cDNA) molecules. The core function of this kit is to enable the reverse transcription process, which is a crucial step in various molecular biology techniques, such as gene expression analysis and RNA sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Stepone real time pcr system, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Stepone real time pcr instrument, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Tripure total rna extraction reagent, by Elk Biotechnology (1 mentions)
Stepone real time pcr machine, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Elk Biotechnology (1 mentions)
Qufast sybr green pcr master mix kit, by Elk Biotechnology (1 mentions)
Tripure total rna extraction kit, by Elk Biotechnology (1 mentions)
Qufast sybr green pcr master mix, by Elk Biotechnology (1 mentions)
Enturbo sybr green pcr supermix kit, by Elk Biotechnology (1 mentions)
7 protocols using m mlv reverse transcriptase kit
1
Cytokine mRNA Expression Analysis
2
Quantitative mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from target tissues or cultured cells using TRIzol reagent (Invitrogen) as per the manufacturer’s instructions. cDNAs were synthesized using the M-MLV Reverse Transcriptase Kit (ELK Biotechnology, Wuhan, China) for mRNA expression assessment. Real-time PCR was performed using a StepOne™ Real-Time PCR instrument (Thermo Scientific). Tubulin served as a loading control to measure the mRNA level, and the 2−ΔΔCt method was used for calculation. The primer sequence was listed in Table 1
3
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted using the TRIpure Total RNA Extraction reagent (EP013, ELK Biotechnology, China). Complementary DNA (cDNA) was synthesized from 1 µg of RNA using the M-MLV Reverse Transcriptase kit (Eq. 002, ELK Biotechnology). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using the StepOne™ Real-Time PCR System (Life Technologies, USA). The relative micro-RNA (mRNA) expression was calculated using the 2−ΔΔCt method and normalized to β-Actin. The primer information was listed in Table 1 . A concentration of RNA larger than 20ng/ul was considered as qualified samples. The purity of RNA was evaluated spectrophotometrically by determining absorbance ratios of A260/A280. The A260/280 ratio ranged between 1.85 and 2.01.
Sequences of Primers
| Primer | Sequences(5′ − 3′) | Tm | CG% | Product size | |
|---|---|---|---|---|---|
| M-actin | Sense | CTGAGAGGGAAATCGTGCGT | 60 | 55 | 208 |
| Antisense | CCACAGGATTCCATACCCAAGA | 61.3 | 50 | ||
| M-TRAF2 | Sense | GAAAGCGTCAGGAAGCCGTA | 60.5 | 55 | 139 |
| Antisense | AGAGACAGATGAGTTCCCCGC | 60.5 | 57.1 | ||
| M-CEBPα | Sense | CCCCACTTGCAGTTCCAGAT | 59.6 | 55 | 244 |
| Antisense | TGTCCACCGACTTCTTGGCT | 60.2 | 55 | ||
| M-CEBPβ | Sense | CTACTACGAGCCCGACTGCC | 59.9 | 65 | 120 |
| Antisense | AGGTAGGGGCTGAAGTCGATG | 60.7 | 57.1 | ||
4
Quantitative Analysis of circNUP98, miR-519a-3p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The complementary DNA (cDNA) was synthesized by using the M-MLV Reverse Transcriptase Kit (ELK Biotechnology, Wuhan, China) with the following conditions: 42°C for 60 min, 85°C for 5 min, and hold at 4°C. Following the preparation of cDNA samples, qPCRs were performed to determine the expression levels of circNUP98, pre-mature miR-519a-3p, and mature miR-519a-3p. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 were selected for internal controls. PCR thermal cycling were as follows: 95°C for 1 min, followed by 40 cycles of 95°C for 15 s, 58°C for 20 s, and a final extension of 72°C for 45 s. The relative expression levels were calculated by using the 2−ΔΔCT method (21 (link)) and the samples were run in triplicate. The primer sequences are listed in Table 1 .
5
Colorectal Cancer Transcriptome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (ELK Biotechnology, Wuhan, China) was used to isolate total RNA from colorectal cancer tissues. On 1% agarose gels, degradation and contamination of RNA were monitored after isolation. Synthesis of first-strand cDNA was performed using an M-MLV Reverse Transcriptase kit (ELK Biotechnology, Wuhan, China). Quantitative real-time PCR was completed on a StepOne™ Real-Time PCR machine (Life Technologies, CA, United States) with 3 replicate per sample using QuFast SYBR Green PCR Master Mix kit (ELK Biotechnology, Wuhan, China). GAPDH was used as an endogenous control gene. The reactions were incubated at 95 °C for 1 min, followed by 40 cycles at 95 °C for 15 s, 58 °C for 20 s and 72 °C for 45 s. Calculation of relative expression levels was performed using the 2−ΔΔCT value relative quantification. The primer sequences were as follows: RP5-881L22.5 (ENSG00000226812) Sense: 5’- TATTGAGCACCTACTATGTACCAGG -3’ and Antisense: 5’- GTTAGAGCTCAGTCTCTCACAGCTC -3’; and GAPDH Sense: 5’- CATCATCCCTGCCTCTACTGG -3’ and Antisense: 5’- GTGGGTGTCGCTGTTGAAGTC -3’.
6
Cardiomyocyte RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cardiomyocytes using TRIpure Total RNA Extraction kit (Cat: EP013) form ELK Biotechnology Co. Ltd., China according to the manufacturer’s instructions. Reverse transcription to make cDNA was conducted using M-MLV Reverse Transcriptase kit (Cat: EQ002) also from ELK Biotechnology Co. Ltd., China. Quantitative real-time PCR was performed using StepOne™ Real-Time PCR system (Life Technologies, CA, USA) using QuFast SYBR Green PCR Master Mix (Cat: EQ001, ELK Biotechnology Co.Ltd., China. A 10-μl total reaction volume was used, and the reaction were as follows: 95 °C for 1 min; 40 cycles of 95 for 15 s, 58 °C for 20 s and 72 °C for 45 s, melting curve 60 °C → 95 °C, with 1 °C temperature increase every 20 s. Beta-actin was used as the endogenous control for data normalization and the double delta method used to calculate gene expression. Ct values used for calculations were averages of three independent repeats. All primer information is provided in Additional file 1 : Table S1.
7
Quantifying miR-21-5p Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Firstly, TRIZOL was used to extract RNA from the samples, and after which the First strand cDNA was synthesized using M-MLV Reverse Transcriptase kit (#EQ002, ELK Biotechnology, Wuhan, China). Next, the Real-time quantitative PCR was performed using the EnTurbo™ SYBR Green PCR SuperMix kit (#EQ001, ELK Biotechnology, Wuhan, China), and each sample was repeated with three multiple wells.
The 2 -ΔΔCt method was used to calculate the relative mRNA expression. The primers are as follow: miR-21-5p, Forward Primer: 5'-GCCCGCTAGCTTATCAGA CTGATG-3', Reverse Primer: 5'-GTGCAGGGTCCGAGGT-3'; GADPH, Forward Primer: 5'-CCGTTGAATTTGCCGTGA-3'; Reverse Primer: 5'-TGATGACCCTTTTGGCTCCC-3'.
The 2 -ΔΔCt method was used to calculate the relative mRNA expression. The primers are as follow: miR-21-5p, Forward Primer: 5'-GCCCGCTAGCTTATCAGA CTGATG-3', Reverse Primer: 5'-GTGCAGGGTCCGAGGT-3'; GADPH, Forward Primer: 5'-CCGTTGAATTTGCCGTGA-3'; Reverse Primer: 5'-TGATGACCCTTTTGGCTCCC-3'.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!