Superscript 3 sybr green qrt pcr kits

Total RNA was isolated using TRIzol (Life Technologies; Carlsbad, CA, USA) and quantified. Equal amount of RNA was used for the one-step qPCR performed using the Superscript III SYBR Green qRT-PCR kits, according to manufacturer's instructions (Life Technologies; Carlsbad, CA, USA) on a Mastercycler ep gradient S realplex² thermal cycler (Eppendorf: Hamburg, Germany, USA). The primers were designed using Primer 3 [50 (link)] and synthesized by Integrated DNA Technologies (Coralville, IA, USA). The sequences of the primers used are: MIEN1 FP-5′cagtgctgtggagcagt3′, MIEN1 RP-5′gacggctgttggtgatcttt3′; GAPDH FP-5′gagcgagatccctccaa3′, GAPDH RP-5′actgtggtca tgagtccttc3′; DNMT1 FP-5′tacctggacgaccctgacctc3′, DNMT1 RP-5′cgttggcatcaaagatggaca3′; DNMT3a FP-5′tattgatgagcgcacaagagagc3′, DNMT3a RP-5′gggtgttc cagggtaacattgag3′; DNMT3b FP-5′ggcaagttctccgagg tctctg3′, and DNMT3b RP-5′tggtacatggcttttcgatagga3′.

Total RNA was isolated from the cell lines using TRIzol (Life Technologies) and quantified. Equal amount of RNA was used for the one-step or two-step qPCR performed using the Superscript III SYBR Green qRT-PCR kits, according to manufacturer’s instructions (Life Technologies). For miRNA, PCR was performed using NCode VILO miRNA cDNA Synthesis and EXPRESS SYBR GreenER miRNA qRT-PCR Kits (Life Technologies), according to the manufacturer’s protocol. The primers (sequences provided in the Supplementary materials and methods; Additional file 7) were designed using Primer 3 [48 (link)] and synthesized by Integrated DNA Technologies (Coralville, IA). PCR was performed using Realplex² Mastercycler ep gradient S thermal cycler (Eppendorf).