Massarray compact analyzer

Raw sequence chromatograms were examined using Chromas version 2.6.2 (Technelysium Pty Ltd, Brisbane, Australia) before consensus sequences were created using BioEdit Sequence Alignment Editor version 7.2.5 [15 ]. spa types were assigned using the online spa type finder/identifier software, http://spatyper.fortinbras.us/ (Fortinbras Research). spa types were further confirmed using the Ridom spa Server, https://www.spaserver.ridom.de/ (Ridom GmbH, Würzburg, Germany) [16 (link)]. For MLST loci, consensus sequences were aligned using the online alignment tool, MAFFT version 7 https://mafft.cbrc.jp/alignment/server/. Sequence types were assigned on the MLST database, www.mlst.net [14 (link)], using the ‘Exact or Nearest Match’ option. The SpectroAcquire program was used for data acquisition on the MassARRAY Compact Analyzer (Agena Bioscience, Hamburg, Germany) and detection parameters were set at 10 laser shots per raster position with a threshold of 5 good spectra per sample pad. In estimating the accuracy of iPex MassARRAY, all isolates were listed with their SNP genotypes and corresponding spa and MLST sequence types (STs). Spa and MLST classifications were used as the reference methods. The accuracy of iPlex MassARRAY was determined as the proportion of isolates whose SNP genotypes corresponded to particular spa/MLST types without ambiguity.

The mosaic mutation was confirmed by using iPLEX and MALDI-TOF MS (Agena Bioscience, Hamburg, Germany). The iPLEX reaction was performed according to the standard protocol recommended by the system supplier (21 (link)). The homogeneous MassEXTEND (hME) and iPLEX process reley on a small volume PCR amplifying the target regions including the SNP position in a multiPLEX fashion. The basic principle of hME and iPLEX reaction is identical. Both methods use a third, so-called MassEXTEND primer, which anneals directly adjacent to the SNP position. In an enzymatic primer extension reaction, this primer will be elongated. During that process the allele-specific analytical products are generated. The products differ by mass according to the incorporated bases. Primers were designed: ACGTTGGATGCTGTGAGCACCAATTTGGAC (PHEX-ex21_PCR1) and ACGTTGGATGTTCTCTTCTAGGTGAGGTGC (PHEX-ex21_PCR2), with the tag-sequences in italics. For the iPLEX-reaction the primer sequences were: ACAGACCAGAAGCTGCC (left) and CCAATTTGGACTTGTTCTC (right). The sample carrier was introduced into the mass spectrometer (MassARRAY Analyzer Compact, Agena Bioscience) and data are fully automatically acquired and analyzed in a real-time setting and revised using Typer software (Agena Bioscience).