After treatment as descripted in Section 2.5 , the total RNA of Caco-2 cells was extracted according to the instructions of the RNA extraction kit, and the concentration and purity of RNA were detected by UV spectrophotometer (486.4–736.2 μg/mL, OD260/280: 2.05–2.08). After the synthesis of first-strand cDNA from 1 μg of RNA using the reverse transcription kit HiScript® II Q select RT Supermix for qPCR (+gDNA wiper), qPCR detection was carried out by a CFX96 fluorescence quantitative PCR detection system (Bio-Rad) with a ChamQ Universal SYBR qPCR Master Mix Kit. The primer sequences (forward and reverse) required for the experiment were shown in supplementary Table S1 . The mRNA expression levels were expressed by 2−ΔΔCT method with GAPDH as the reference gene [20 (link)].
Chamq universal sybr qpcr master mix kit
Manufactured by Bio-Rad
Sourced in United States
The ChamQ Universal SYBR qPCR Master Mix Kit is a ready-to-use solution for quantitative real-time PCR (qPCR) experiments. It contains all the necessary components, including a SYBR Green-based dye, for the amplification and detection of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Cfx96 real time system pcr instrument, by Bio-Rad (1 mentions)
Cfx96 real time system, by Bio-Rad (1 mentions)
Hiscript 3 1st strand cdna synthesis kit, by Vazyme (1 mentions)
Rnaeasy animal rna isolation kit, by Beyotime (1 mentions)
Nanodrop one spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Iq5 real time pcr detection system, by Bio-Rad (1 mentions)
4 protocols using chamq universal sybr qpcr master mix kit
1
RNA Extraction and qPCR Analysis of Caco-2 Cells
2
Transcriptomic Analysis of Cytokine Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells in each treatment group using an RNA Fastagen Kit and reverse-transcribed into cDNA using a HiScript II 1st Strand cDNA Synthesis Kit (+ gDNAwiper). RT-qPCR was performed using ChamQ Universal SYBR qPCR master mix kit and specific primers for glycerol 3-phosphate dehydrogenase (GAPDH), IL-1β, and IL-8 in a CFX96™ Real-time System PCR instrument (Bio-Rad, CA, USA), with GAPDH as the reference gene. The relative mRNA expression levels of IL-1β and IL-8 were calculated using the 2-△△CT method. The CT value of the PRRSV-JXA1 Nsp9 gene was detected using qRT-PCR with AceQ Universal U+Probe master mix V2 and JXA1 Nsp9 specific primers and probes. All experiments were performed in triplicate. The sequences of the gene-specific primers and probes are listed in Table 1 .Table 1
RT-qPCR primer and probe sequences.
| Gene | Primer sequence (5 '−3′) |
|---|---|
| IL-1β-F | GGAAGACAAATTGCATGG |
| IL-1β-R | CCCAACTGGTACATCAGCAC |
| IL-8-F | AGGACAAGAGCCAGGAAG |
| IL-8-R | CTGCACCTTCACACAGAGC |
| Nsp9-F | CCTGCAATTGTCCGCTGGTTTG |
| Nsp9-R | GACGACAGGCCACCTCTCTTAG |
| JXA1-Nsp9-Probe | ACTGCTGCCACGACTTACTGGTCACGCAGT |
| GAPDH-F | CCTTCCGTGTCCCTACTGCCAAC |
| GAPDH-R | GACGCCTGCTTCACCACCTTCT |
3
RNA Extraction and RT-qPCR Analysis of Liver and Gut
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA of the liver and gut was extracted using the RNAeasyTM Animal RNA isolation kit (Beyotime, Shanghai, China) following the manufacturers’ instructions. The quantity and quality of total RNA were determined by using NanoDrop® One spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Total RNA (1 μg) was used for reverse transcription with the HiScript III 1st Strand cDNA Synthesis Kit (R323-01, Vazyme, Nanjing, China). Quantitative RT–PCR was performed using the ChamQ Universal SYBR qPCR Master Mix kit on a quantitative thermal cycler CFX96TM Real-Time System (Bio-Rad, Hercules, CA, USA). The mRNA levels were calculated by the 2−ΔΔCt method as the fold expression relative to the housekeeping gene, actb2. All primer sequences are listed in Table 2 .
4
Quantitative Analysis of NEM1 and miR-139-5p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After treatment, the total RNA was extracted from Huh7 and Hep3B cells using Total RNA Extraction Reagent (cat. No. R401-01; Vazyme, Nanjing, China.). The cDNA of NEM1 was synthesized from 1 μg of total RNA using HiScript II One Step RT-PCR Kit (cat. No. P611-01; Vazyme). The transcription reaction of miR-139-5p was performed using 1 μg of total RNA with the miRNA 1st Strand cDNA Synthesis Kit (cat. No. MR101-01; Vazyme). The qPCR was performed using an iQ5 real-time PCR detection system (Bio-Rad Laboratories, Hercules, USA) with a ChamQ Universal SYBR® qPCR Master Mix kit (cat. No. Q311-02, Vazyme). The thermocycling conditions were: 96°C for 5 min, followed by 42 cycles at 96°C for 25 s, 58°C for 30 s and 72°C for 25 s. Expression levels were measured using the 2 -ΔΔCt method and normalized to those of U6 or 18s rRNA. The primers for reverse transcription and qPCR are shown in Table 4.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!