Y27632

For genome targeting using Crispr–Cas9 appraoches, gRNAs were designed using the online software GPP sgRNA Designer (Broad Institute) and cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 vector. Exon1-gRNA (CCATCTGGCTGTACCAGTTC) and Exon 2-gRNA (CCATCACTCGCGCCTACTAC) were chosen for the generation of RAB39b KO hPSCs. PX459 V2.0 was a gift from Dr. Feng Zhang's laboratory (Addgene plasmid #62988). RAB39b KO hPSCs were generated using a previously published method (Ran et al. 2013 (link)). Briefly, hPSCs were treated with ROCK inhibitor Y27632 (10 µM; Selleckchem) for 24 h prior to electroporation. The cells were dissociated into single cells using Accutase. Three micrograms of plasmids was electroporated into 8.0 × 10⁵ cells using Amaxa Nucleofector II eletroporator (Lonza) with human stem cell nucleofector kit 1 (Lonza), then immediately plated on Geltrax-coated plates and cultured in mTeSR medium containing Y27632 (50 µM) for the first 24 h. Puromycin (0.5 µg/mL) was added to the medium for 2-d selection. Subsequently, hPSCs were maintained in medium without puromycin until colonies emerged. Individual colonies were picked up and expanded. PCR products were amplified and subjected to Sanger sequencing to identify mutant clones. The primers were Rab39b-Forward (GTCTACGCGGGGGATTACAG) and Rab39b-Reverse (TGTTATTGACCGGCCTTCCC).

Human iPSC-derived microglia cells were generated from the BIONi010-C human iPSC line (EBiSC), originating from a non-demented, normal male (15–19 years old). Differentiation to human iPSC-derived microglia was essentially as described by Xiang et al.⁷⁸ (link) Briefly, the protocol was as follows: embryoid body differentiation media for 2 days (consisted of Essential 8^TM, 50 ng/ml BMP4, 50 ng/ml VEGF, 20 ng/ml SCF, and 10 µM Y-27632), then myeloid differentiation media for 30 days [consisted of X-VIVO^TM 15 medium (Lonza), GlutaMAX^TM (Life Technologies), 100 U/ml penicillin/streptomycin (Life Technologies), 50 µM β-mercaptoethanol (Life Technologies), 100 ng/ml MCSF (Peprotech), and 25 ng/ml IL-3 (Cell Guidance Systems)]. These myeloid cells were seeded at a density of 5 × 10⁵ cells/well in six-well plates, followed by microglial differentiation media for 13 days [consisted of: DMEM/F12 HEPES no phenol red, 2% ITS-G (Life Technologies), 1% N2 supplement (Life Technologies), 200 µM monothioglycerol (Sigma), GlutaMAX^TM, NEAA (Life Technologies), 5 µg/ml insulin (Sigma), 100 ng/ml IL-34 (Peprotech), 25 ng/ml MCSF and 5 ng/ml TGFβ-1 (Peprotech)] and finally, microglia maturation media for 4 days [consisted of: microglial differentiation media plus 100 ng/ml CD200 (Generon), and 100 ng/ml CX3CL1 (Peprotech)].