Sicontrol non targeting sirna pool 1

Transfections were performed in HDFs, CD34+/CD45− and CD91+/CD45− cells using Lipofectamine 2000 according to the manufacturer’s protocol (Invitrogen). In all experiments, a second transfection was performed 2 days after the primary transfection. The transfected cells were analyzed 2 days after the second transfection or 10 days if grown in Endothelial Differentiation Media. The CD34 small interfering RNA (siRNA) knockdowns were performed in cells by following a previously described transfection protocol^{28 (link)}(Krumins & Gilman, 2006). CD34 siRNAs and control siRNAs were purchased from Dharmacon. For CD34+ siRNA silencing, an ON-TARGET plus SMARTpool L-019503-00-0005 was used (sequences 5′- UAACCUCAGUUUAUGGAAA −3′, 5′- GCACUAGCCUUGCAACAUCC −3′, 5′-GCGCUUUGCUUGCUGAGUU −3′, and 5′- CCACUAAACCCUAUACAUC −3′ based on GenBank accession number NM_001773). The siCONTROL Non-Targeting siRNA Pool #1 was used for control siRNA transfections (Dharmacon).