The largest database of trusted experimental protocols

Recombinant mouse amphiregulin

Manufactured by BioLegend

Recombinant mouse Amphiregulin is a growth factor protein produced in a recombinant expression system. It is a member of the epidermal growth factor (EGF) family and plays a role in cell growth and differentiation.

Automatically generated - may contain errors

2 protocols using recombinant mouse amphiregulin

1

Transcriptional Analysis of Pancreatic Islet Stress

Check if the same lab product or an alternative is used in the 5 most similar protocols
Pancreatic islets were isolated from NOD.scid mice as described above. Whole islets were then cultured in RPMI supplemented with 10% Fetal Bovine Serum (FBS) for 7 h. Additional stimulation conditions included recombinant mouse Areg (100 ng/mL) (Recombinant mouse Amphiregulin, Carrier-free, Biolegend), Thapsigargin (5 uM) (Enzo Life Sciences), or mAreg plus Thapsigargin. After 7 h, total RNA was extracted following the manufacturer’s protocol from Qiagen RNeasy kit. First strand cDNA synthesis was performed using the manufacturer’s protocol from High-Capacity Reverse Transcriptase kit (Applied Biosciences). The following targets were analyzed by qPCR (Insulin, Grp78, sXBP1, CHOP, ATF4, ATF6, GAPDH) using a QuantStudio6 (Applied Biosystems). Primers for each target are listed in Table 1.

Primer sequences of targets used in qPCR.

TargetSequence
InsulinForwardGTCAAGCAGCACCTTTGTGGTTCC
ReverseACAATGCCACGCTTCTGCTG
Grp78ForwardTGCTGCTAGGCCTGCTCCGA
ReverseCGACCACCGTGCCCACATCC
sXbp1ForwardGAGTCCGCAGCAGGTGC
ReverseCAAAAGGATATCAGACTCAGAATCTGAA
Atf4ForwardGCCGGTTTAAGTTGTGTGCT
ReverseCTGGATTCGAGGAATGTGCT
Atf6ForwardGATGCAGCACATGAGGCTTA
ReverseCAGGAACGTGCTGAGTTGAA
ChopForwardCGGAACCTGAGGAGAGAGTG
ReverseCGTTTCCTGGGGATGAGATA
GapdhForwardTGCACCACCAACTGCTTAG
ReverseGGATGCAGGGATGATGTTC
+ Open protocol
+ Expand
2

Pancreatic Islet RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Pancreatic islets were isolated from NOD.scid mice as described above. Whole islets were then cultured in RPMI supplemented with 10% Fetal Bovine Serum (FBS) for 7 hrs. Additional stimulation conditions included recombinant mouse Areg (100ng/mL) (Recombinant mouse Amphiregulin, Carrier-free, Biolegend), Thapsigargin (5uM) (Enzo Life Sciences), or mAreg plus Thapsigargin. After 7 hrs, total RNA was extracted following the manufacturer’s protocol from Qiagen RNeasy kit. First strand cDNA synthesis was performed using the manufacturer’s protocol from High-Capacity Reverse Transcriptase kit (Applied Biosciences). The following targets were analyzed by qPCR (Insulin, Grp78, sXBP1, CHOP, ATF4, ATF6, GAPDH) using a QuantStudio6 (Applied Biosystems). Primers for each target are listed in Table 1.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!