ChIP for histone modifications and transcription factors was performed from sorted WT and ΔIkE5Cd2 large pre-B cells as described previously (Hu et al. 2016 (link)). In addition, ChIPs for Mi-2β and CTCF were performed with antibodies ab72418 (Abcam) and 2899s (Cell Signaling), respectively. DNA recovered from ChIP was used to generate libraries for sequencing. Briefly, 2.5–40 ng of DNA was end-repaired, end-adenylated, and then ligated with Illumina TruSeq-indexed adaptors. The ligated DNA was purified with AMPure XP beads (Beckman Coulter) and then amplified with KAPA HiFi DNA polymerase (KAPA Biosystems) for eight to 13 cycles. After amplification, the library DNA was separated on a 2% agarose gel, and DNA fragments in the 200- to 500-bp range were purified with a gel DNA recovery kit (Zymo Research). The purified DNA was diluted to 10 nM and multiplexed for sequencing at the Bauer Center Systems Biology Core at Harvard University. Image analysis and base calling were performed using the Illumina HiSeq 2000 software. Raw sequencing data sets were uploaded to DNAnexus, a cloud-based genome informatics and data management platform.
Gel dna recovery kit
Manufactured by Zymo Research
Sourced in United States
The Gel DNA Recovery Kit is a laboratory tool designed to extract and purify DNA fragments from agarose gels. It provides a simple and efficient method to recover DNA of various sizes from gel electrophoresis for further downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Kapa hifi dna polymerase, by Roche (3 mentions)
Truseq indexed adaptors, by Illumina (2 mentions)
Ampure xp bead, by Beckman Coulter (2 mentions)
Nebnext ultra 2 pcr protocol, by New England Biolabs (2 mentions)
Sequencing library qpcr quantification guide, by Illumina (2 mentions)
Hi di formamide, by Thermo Fisher Scientific (2 mentions)
Genescan 500 liz dye size standard for abi3130xl, by Thermo Fisher Scientific (2 mentions)
Phusion dna polymerase, by New England Biolabs (2 mentions)
Restriction enzyme, by New England Biolabs (2 mentions)
T4 dna ligase, by New England Biolabs (2 mentions)
Oligodeoxyribonucleotides, by Integrated DNA Technologies (2 mentions)
3 race system, by Thermo Fisher Scientific (2 mentions)
Ab72418, by Abcam (1 mentions)
Hiseq 2000, by Illumina (1 mentions)
Mastercycler nexus, by Eppendorf (1 mentions)
Sequalprep normalisation kit, by Thermo Fisher Scientific (1 mentions)
Hifi hotstart readymix, by Roche (1 mentions)
Dna clean and concentrator 25, by Zymo Research (1 mentions)
Nebnext multiplex oligos for kit, by Illumina (1 mentions)
Topo ta cloning kit, by Thermo Fisher Scientific (1 mentions)
21 protocols using gel dna recovery kit
1
ChIP-seq of Histone Modifications and Transcription Factors
2
Dual-Indexed 16S rRNA Amplicon Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A library was prepared for the V3-V4 region of the 16S rRNA gene using dual-indexed primers42 (link) (Supplementary Table S6 ). Each reaction plate contained a positive and negative control. PCR amplicons were generated in duplicate using barcoded 319F and 806R primers with reaction mix containing: 5–50 ng DNA; 1 x HiFi Hot Start Ready Mix (KAPA Biosystems; Cape Town, South Africa); and 1 µM of each primer made up to a final volume of 25 µL with molecular-grade water. Thermocycling was performed on a Nexus Mastercycler (Eppendorf; Hamburg, Germany) using a 3 minute initial denaturation at 95 °C followed by 30 cycles at: 95 °C for 15 seconds; 55 °C for 15 seconds; 72 °C for 30 seconds, and then a final 72 °C extension for 5 mins. PCR products were cleaned and standardised using SequalPrep Normalisation kit (Invitrogen; Carlsbad, CA) and then pooled. The pooled library preparation was concentrated using DNA Clean and Concentrator-25 (Zymo Research; Irvine, CA), and residual primers removed using a Gel DNA Recovery Kit (Zymo Research; Irvine, CA). The pooled library preparation was sequenced on MiSeq platform using 600-cycle kit chemistry v3 (Illumina; San Diego, CA) by Ramaciotti Centre for Genomics (Sydney, Australia).
3
Illumina DNA Library Preparation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Library preparation was done using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs). To prepare samples, 34 µL DNase-free water was added to 16 µL precipitated DNA and adaptors were ligated to DNA fragments according to the manufacturer's instructions (NEBNext Multiplex Oligos for Illumina kit NEB). After ligation, the DNA samples were cleaned up using AMPure XP beads (0.9x) (Beckman Coulter).
Resulting fragments were amplified for 14 cycles using NEBNext Ultra II PCR protocol (New England BioLabs) and quality was assessed with the Agilent High sensitivity DNA kit.
Amplicons were excised from a 2 % agarose gel (200-800 bp fragments were excised) and purified using the Gel DNA recovery kit (Zymo Research). Library concentrations were measured with qPCR according to Illumina's Sequencing Library qPCR Quantification Guide.
Sequencing was done on a NextSeq500 using single reads (76 bp). A 2.3 pM library was loaded on the flow cell with 2 % PhiX spike-in.
Resulting fragments were amplified for 14 cycles using NEBNext Ultra II PCR protocol (New England BioLabs) and quality was assessed with the Agilent High sensitivity DNA kit.
Amplicons were excised from a 2 % agarose gel (200-800 bp fragments were excised) and purified using the Gel DNA recovery kit (Zymo Research). Library concentrations were measured with qPCR according to Illumina's Sequencing Library qPCR Quantification Guide.
Sequencing was done on a NextSeq500 using single reads (76 bp). A 2.3 pM library was loaded on the flow cell with 2 % PhiX spike-in.
4
Bisulfite Conversion and Sequencing
5
Reagents and Buffers for Molecular Biology
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All routine chemical reagents were purchased from Sigma Chemicals (St Louis, MO, USA), Fisher Scientific (Suwanee, GA, USA), or VWR (Suwanee, GA, USA). Restriction enzymes, Phusion DNA polymerase, and T4 DNA ligase were purchased from New England Biolabs (Beverly, MA, USA). BSA and dNTPs were purchased from Promega (Madison, WI, USA). The gel DNA recovery kit was purchased from Zymo Research (Irvine, CA, USA). Oligodeoxyribonucleotides were ordered from Integrated DNA Technologies Inc. (Coralville, IA, USA) and Eurofins Genomics (Huntsville, AL, USA). The LB (Miller) medium was prepared according to standard recipes. Hi‐Di™ Formamide and GeneScan™ 500 LIZ™ dye Size Standard for ABI3130xl were purchased from Applied Biosystems (Waltham, MA, USA). The sonication buffer consisted of 20 mm Tris‐HCl (pH 7.5), 1 mm EDTA (pH 8.0), 50 mm NaCl, 2.5 mm dithiothreitol and 0.15 mm phenylmethanesulfonyl fluoride. The TE buffer consisted of 10 mm Tris‐HCl (pH 8.0) and 1 mm EDTA.
6
Amplification and Sequencing of rpoB Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using genomic DNA as a template, the rpoB gene was amplified with the following two primer pairs for direct sequencing. Primer pair 1: 5′‐AAACTGTGCCGAT GGTGGAC‐3′ (5′ position 1058) and 5′‐TAGCTCACGCGGCCATTCAC‐3′ (5′ position 1945). Primer pair 2: 5′‐TCTTTCCCATCGACGAGTCC‐3′ (5′ position 173) and 5′‐CACGATGGGGCGGTT GTT‐3′ (5′ position 1224). The PCR reaction included 1 × Phusion HF buffer (Thermo Scientific, Walthem, MA, USA), 50 pmol each PCR primer, 40 nmol dNTP, 3% dimethylsulfoxide, 0.5 units of Phusion DNA polymerase (Thermo Scientific), 10 ng of genomic DNA, and double‐distilled H2O. The DNA was denatured at 95° for 4 min, amplified for 30 cycles of 95° for 30 s, 57° for 30 s, and 72° for 1 min and extended for 7 min at 72°. PCR products were purified with the Gel DNA recovery kit (Zymo Research) and sequenced with one of two primers, 5′‐CATGCTGCTCGGCAACCC‐3′ (5′ position 1221) or 5′‐TGATTCACAAAGACACTGGCGT‐3′ (5′ position 323), respectively.
7
Amplicon-based NGS for CRISPR indel analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCR amplification product of size 200–300 base pairs flanking the sgRNA target sites sites or that of size 150–200 base pairs flanking the scar sequence of the gene circuit were purified with gel DNA recovery kit (Zymo Research Corp.). The DNA library was prepared with Illumina TruSeq Nano DNA library Construction (insert size 350 bp). The resulting DNA library was sequenced with HiSeq4000 (Illumina, 150nt paired-end). The next generation sequencing data was analyzed for indel frequency using CRISPRESSO233 (link). The primers used for generating amplicon for NGS analysis are listed in Supplementary Table 5 .
8
Engineered mCherry-Drp1 Constructs
9
Molecular Biology Reagent Purchasing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All routine chemical reagents were purchased from Sigma Chemicals (St. Louis, MO), Fisher Scientific (Suwanee, GA), or VWR (Suwanee, GA). Restriction enzymes, Phusion DNA polymerase, and T4 DNA ligase were purchased from New England Biolabs (Beverly, MA). Bovine serum albumin and dNTPs were purchased from Promega (Madison, WI). Gel DNA recovery Kit was purchased from Zymo Research (Irvine, CA). Oligodeoxyribonucleotides were ordered from Integrated DNA Technologies Inc. (Coralville, IA) and Eurofins Genomics (Huntsville, AL). The LB medium was prepared according to standard recipes. Hi-Di formamide and GeneScan 500 LIZ dye Size Standard for ABI3130xl were purchased from Applied Biosystems. The Tth UDGa sonication buffer consisted of 20 mM Tris-HCl (pH 7.5), 1 mM ethylenediaminetetraacetic acid (EDTA) (pH 8.0), 2.5 mM DTT, 0.15 mM PMSF, and 50 mM NaCl. The GeneScan stop buffer consisted of 80% formamide (Amresco, Solon,OH), 50 mM EDTA (pH 8.0), and 1% blue dextran (Sigma Chemicals). The TE buffer consisted of 10 mM Tris-HCl (pH 8.0) and 1 mM EDTA.
10
Illumina Adapter Ligation and Indexing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The final PCR amplification appends the remaining Illumina adapters and the desired demultiplexing index. Reactions were set up with the following reaction components: 5 μl Click-ligated cDNA, 2.5 μl 5 μM Indexing primer (CAAGCAGAAGACGGCATACGAGATnnnnnnGTGACTGGAGTTCAGACGTGT, where nnnnnn is the sequence of the desired index), 2.5 μl 5 μM Short Universal Primer (AATGATACGGCGACCACCGAG), and 25 μL 2X One Taq Standard Buffer Master Mix for a final 50 μl reaction. Optimized thermocycler conditions are as follows: 94° 4 min; 53° 30 s; 68° 10 min; [94° 30 s, 53° 30 s, 68° 2 min] × 20–22; 68° 5 min. Amplified PCR product was then run on a 2% precast agarose e-gel (Invitrogen, E-Gel Electrophoresis System) for 10 min and ∼200–300 bp fragments (for 1 × 150 SE Illumina) or ∼200–400 bp fragments (for 1 × 250 SE Illumina) were excised and cleaned using the Zymo Research Gel DNA Recovery Kit. Final yield of size selected cDNA library was quantified using a QuBit fluorimeter.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!