Revertaid first strand cdna synthesis kit

Reverse transcription PCR was performed using the RevertAid First Strand cDNA Synthesis Kit (ThermoFisher Scientific, #K1622, Waltham, MA, USA) and 500 ng of total RNA in a 20 μL reverse transcription reaction volume. Combined oligo (dT) and random hexamer primers were used, each with a final concentration of 2.5 μM, to prime the reverse transcription for both mRNAs and lncRNAs. Reverse transcription and quality control PCR were performed using the T100 PCR system (Bio-Rad Laboratories Inc., Hercules, CA, USA). Quality and purity (absence of DNA contamination) of the cDNA were measured by PCR using the PPP MasterMix (Top-Bio, s.r.o., Prague, Czech Republic) with GAPDH primers from the RevertAid First Strand cDNA Synthesis Kit (ThermoFisher Scientific Inc.). Control PCR was conducted for 40 cycles in 10 μL reactions using 5 μL of PPP MasterMix, 3.5 μL molecular water and 0.5 μL GAPDH primer mix with 1 μL of sample or reverse transcriptase negative control.

RNA was isolated out of lung biopsies of the right lung lobe using the RNeasy Minikit (Qiagen; Hilden, Germany). For reverse transcription, 2 µg RNA was used with RevertAid First Strand cDNA synthesis kit (ThermoScientific, Waltham, MA, USA), or Ready-To-Go You-Prime First-Strand Beads kit (GE; Boston, MA, USA). qRT-PCR was performed like described before (24 (link)). Primers specific for sense orientation of OVA expression cassette were used (AAGAGTCAAATGGCTCTCCTCAAGCGTATT and GTCTGTTGTGCCCAGTCATAGCCGAATAG). OVA expression was related to expression of lung tissue-specific surfactant protein C (Spc) gene (CACCATCGCTACCTTTTCCA and CTCGGAACCAGTATCATGCC). As indicated, in some experiments GAPDH was used as reference housekeeping gene [primers provided in RevertAid First Strand cDNA synthesis kit (ThermoScientific, Waltham, MA, USA)].

For gene expression analysis, total RNA was isolated from the muscle tissues of animals using TRIzol reagent (Life Technologies, USA). In total, 2000 ng of RNA was reverse-transcribed to cDNA using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA). PCR was performed using cDNA as a template in a 20 μl reaction mixture containing specific primers (Sangon Biotech, China). The primers are listed in Supplementary Table S1. Each sample was normalized to β-actin. The reaction was performed in a thermal cycler (Bio-Rad CFX96, USA) according to the following standard protocol: one cycle of 95 °C for 3 min, followed by 45 cycles of 95 °C for 15 s, annealing for 20 s, and 72 °C for 30 s. Next, we confirmed that β-actin was a stable reference gene in the gastrocnemius by determining the Ct values of the normal, 14 days post-operation (dpo) and 28 dpo groups, as shown in Supplementary Figure S1.
For microRNA expression analysis, 2000 ng of total RNA was reverse-transcribed by miR-434-3p- or U6 (internal control)- specific RT primer (RiboBio, China) and a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA). PCR was performed using a standard protocol with a 20 μl reaction mixture containing specific primers (RiboBio, China). Each sample was normalized to U6.

For validation of mRNA and miRNA sequencing expression results, 11 DEGs (including 6 hub genes) and 7 DEmiRNAs were randomly selected and analyzed by RT-qPCR. Primers were designed using Primer 5.0 software (Supplementary Table S1) and synthesized by Sangon Biotech (Shanghai) Co. Ltd. RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, United States) was used to reverse transcribe the total RNAs into cDNA following the manufacturer’s protocols for mRNA. Then qPCR was conducted using QuantiNova SYBR Green PCR Kit (QIAGEN, Shanghai, China). For miRNA, specific reverse transcription primers with step loop were synthesized and reverse transcription were performed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, United States). The qPCR was completed using QuantiNova SYBER Green PCR Kit (QIAGEN, Shanghai, China). GAPDH gene and U6 were used for normalizing the relative abundance of genes and miRNAs, respectively. The 2^-ΔΔCt method (Livak and Schmittgen, 2001 (link)) was used to analyze the data for all samples in triplicate technical replicates.

Total RNA was extracted using Tripure (Roche) from microglia plated in 6-well plates. After DNase I treatment (Sigma), RNA (1 μg/sample) was reverse transcribed using RevertAid First Strand cDNA Synthesis kit (Fermentas) and random hexamer primers. The cDNA was analyzed by qPCR in triplicates on a Cfx96-Cycler (Bio-Rad) with the SensiFAST™ SYBR® No-ROX Kit (Bioline) and 2.5 pmol of the following primers: mouse Rac1 forward, CCC AAT ACT CCT ATC ATC CTC G; mouse Rac1 reverse, CAG CAG GCA TTT TCT CTT CC; mouse BDNF forward, CCC TCC CCC TTT TAA CTG AA; mouse BDNF reverse, GCC TTC ATG CAA CCG AAG TA with a primer efficiency of 100.7% and GAPDH forward and reverse primers from the RevertAid First Strand cDNA Synthesis kit (Fermentas), with a primer efficiency of 86.3%. After 42 cycles, the Ct values were determined. To normalize the samples, ΔCt between the gene of interest and GAPDH Ct values as reference gene was calculated. The x-fold difference in expression between the different treatments was then determined by subtraction of the ΔCt values and called ΔΔCt. Finally, the total change was calculated as 2^−ΔΔct and the relative amount compared to Scrambled siRNA-transfected cells was deducted.