Biotek plate reader

Cells were plated in 96-well plate at 2,000 cells per well in five-well replicate. After 4 hours, cells were treated with different chemicals for 5 days. MTT assays were used for quantifying numbers of viable cells with a Biotek plate reader (Biotek Instruments, Winooski, VT, US) as described previously [31 (link)].

High quality DNA was isolated from F₅ plants of the two populations (Pc53 x Otana and Pc53 x Pc50) and parents following a protocol by Anderson et al. [25 (link)] with modifications, including grinding freeze dried leaves with beads in a Mixer Mill MM 300 shaker (Retsch, Hannover, Germany) for 10 min at 25 strokes per second. The concentration and quality of DNA were estimated using the BioTek plate reader (BioTek Instruments Inc., Winooski, VT). Genotyping was performed with an Illumina Infinium iSelect oat SNP chip containing 4975 SNPs at the Cereal Crops Research Unit of ARS-USDA in Fargo, ND. Genotype calling for each RIL and parental line was performed automatically using the DBSCAN procedure in GenomeStudio, v. 2.0 (Illumina, San Diego, CA, 2016), and was manually inspected for call accuracy.

Total collagen was quantified using the QuickZyme kit (QuickZyme Biosciences, Leiden, The Netherlands) following the supplier's instructions. Briefly, snap‐frozen dermal equivalents grown for 7–35 days and standards were hydrolysed in 6 m HCl 3 mg μL⁻¹ wet weight (Thermo Fisher) for 20 h at 95 °C, centrifuged for 10 min at 13 000 g, and the supernatant collected. Samples were diluted in water (for a final concentration of 4 m HCl). All samples were incubated for 60 min at 60 °C with detection reagent before absorbance was read at 570 nm using a Biotek plate reader (Biotek, Swindon, UK). Total collagen values were calculated using the standard and expressed in μg mL⁻¹.

Girard-T reagent was used to determine the inhibition rate of α-dicarbonyl compounds [52 (link)]. Forty microliters of incubation solution, 160 μL of ultrapure water, and 100 μL of 0.5 M Girard-T reagent (dissolved in ultrapure water) were mixed with 1.7 mL of sodium formate solution (0.5 M, pH = 2.9) and incubated at 25 °C for 1 h. After incubation, the absorbance was measured at 290 nm using a Biotek plate reader (BioTek Instruments, Winooski, VT, USA).

The sulforhodamine B (SRB) assay was performed to determine the half maximal inhibitory concentration (IC₅₀) values for gemcitabine sensitivity for each cell line and their hENT1 knockdown counterpart. Cells were seeded in triplicate in flat bottom 96-well plates (EGI-1, 10.000 cells per well; TFK-1, 10.000 cells per well; SK-ChA-1, 20.000 cells per well) and allowed to attach for 24 h before addition of gemcitabine. A separate control plate was seeded in a similar way and used as a t = 0 plate. Gemcitabine was dissolved in dimethyl sulfoxide (DMSO (Sigma-Aldrich) at a 1-mM stock concentration and stored at −20°C. Titrations of gemcitabine (4—1,500 nM) were added to cells of each cell line. After 72 h, cells were fixed in 5% trichloroacetic acid (Sigma-Aldrich), washed thrice with PBS, stained with 0.4% w/v SRB in 1% acetic acid, and resuspended in 10 mM unbuffered Tris in demineralized water. The absorbance was measured at 490 nm on a BioTek plate reader (BioTek Instruments, Winooski, VT, United States). IC₅₀ values were determined using R (R Foundation for Statistical Computing, Indianapolis, IN, United States) and the R-package N-Parameter Logistic Regression (NPLR).

Cas9 protein was diluted into a working buffer (20 mM HEPES, 150 mM KCI, 5% Glycerol, 1 mM DTT, pH 7.5). RNA oligos (crRNA and tracrRNA) were dissolved in nuclease-Free TE Buffer, pH 7.4 and annealed in equimolar concentrations in a sterile microcentrifuge tube. Annealed RNA oligos and Cas9 proteins were incubated together to form a complex for 5 min. The complex was mixed with lipofectamine RNAiMax (Thermo Scientific, Waltham, MA) according to manufacturers’ guide. Then the complex was added to the astrocytes for transfection for 48 hrs. Cells were examined for the CRISPR/Cas9 gene-editing efficiency by fluorescence measurement and genomic DNA PCR as mentioned below. After 48 hours, the treated cells and control cells were seeded into black 96 well plates to read the levels of red fluorescent protein expression by Biotek plate reader (Biotek, Winooski, VT). The background was subtracted from each read, and the fluorescent protein level of the control group was normalized as 100%. The deletion of HIV provirus with combinations of gN and gP; gN and gT was examined by gN and gP deletion primers: DelPNF1, CTGGATGTGGGTGATGCATA; LTRR4, CTCAGGGTCATCCATTCCAT; by gN and gT deletion primers: DelTNF1, GGCAAGTTTGTGGAATTGGT; LTRR4, CTCAGGGTCATCCATTCCAT.