Genejet plasmid miniprep

All pDProm plasmids, containing the gene-less cassettes or lacZ fragments as inserts, were extracted from E. coli DH5α cultures using the GeneJET Plasmid Miniprep (Thermo Scientific), following the manufacturer's instructions. For the preparation of V. cholerae electrocompetent cells, a single colony of V. cholerae N16961 was initially inoculated in 3 ml of LB medium and cultured for 20 h at 37°C. Then, a 1:100 dilution was performed in 10 ml of LB and cultures were grown until reaching an OD₆₀₀ of 0,5. The cultures were washed three times in G buffer (137 mM sucrose, 1 mM HEPES, pH 8.0) by centrifuging at 4000 rpm and 4°C for 8 min. The final pellet was resuspended in 80 μl of G buffer.
Electrocompetent cells (40 μl) were mixed with 1 μl of each purified plasmid in a prechilled Eppendorf tube and transferred to a 0.1-cm electroporation cuvette (MBP). Electroporation was performed at 1400 V for a 5 ms pulse using the Eporator (Eppendorf). Sequentially, cells were cultured with 1 ml of LB for 1 h at 37°C. Selection of V. cholerae clones containing the pDProm and derivative plasmids was accomplished by adding kanamycin (75 μg/ml). Plasmids presence was confirmed by PCR with primers MRVII and MFD and verified by DNA sequencing.

All chemicals used were purchased from AppliChem, Carl Roth, Fluka, Merck, Riedel-de-Haën, Sigma-Aldrich, and VWR International. Both kits, GeneJET Plasmid Miniprep and CloneJET PCR Cloning, were acquired from Thermo Fisher Scientific, whereas the innuPREP Gel Extraction Kit from Analytik Jena was applied. The expression vector pET16bP was handled as described earlier [27 (link)].

GlcNAc, glucosamine 6P (GlcN 6P), glucose 1P (Glc 1P), glucose 6P (Glc 6P), and ATP were purchased from Sigma-Aldrich (Darmstadt, Germany). MurNAc was from Bachem (Bubendorf, Switzerland), and GlcNAc 6P was from Carbosynth. GlcNAc 1P, MurNAc α-1P, and MurNAc 6P were generated by enzymatic synthesis (for a description of the production of these phosphosugars, see Text S1). Enzymes for DNA restriction and cloning were obtained from New England Biolabs (Ipswich, MA), and Gene JET plasmid miniprep and PCR purification kits, isopropyl-β-d-thiogalactopyranoside (IPTG), prestained protein molecular size markers (20 to 120 kDa), and fosfomycin discs (200 µg; Oxoid) were purchased from Thermo Fisher Scientific. Oligonucleotide primers were obtained from MWG Eurofins (Ebersberg, Germany) and are listed in Table S1.

The Cas9 plant expression vector (pHSE401) was digested with BSaI and the DNA fragment containing Cas9 was eluted using a GeneJET (Thermo Fisher Scientific) kit. Ligation of sgRNA in digested pHSE401 was carried out at 22 °C for 4 h using T4 DNA ligase (New England BioLabs), according to Khan et al. [22 ]. After four hours of ligation, the ligation product was transformed into chemically competent cells of E. coli DH5α and colony PCR was performed with specific primers (U6-26-F and dT4-R) to confirm sgRNA ligation:

U6-26-F: 5’TGTCCCAGGATTAGAATGATTAGGC3’

dT4-R: 5’AAACGTAATATTAAACGGATGGCC3’

From the PCR-confirmed clones, plasmid DNA was isolated with a GeneJET Plasmid Miniprep (Thermo Fisher Scientific) kit and, before transformation into Agrobacterium (GV3101), the clones were confirmed through sequencing.

The pACYC184 backbone was amplified by PCR using pACYC184 (GenBank X06403) as template. The aph(3′)-Ia(NEO^R) gene, the sul2_strAB(STREP^R) genes and the aac(3)-IV(GEN^R) gene were amplified by PCR from the E. coli strains 113026-3 (NEO^R) and 113790-2 (GEN^R, STREP^R)^{12 (link)}. All PCR products were generated using Q5 DNA Polymerase (New England BioLabs, Ipswich, USA) with overhang primers (listed in supplementary Table S11). The PCR products containing the plasmid backbone and the selected resistance gene were mixed according to the HiFi cloning protocol (New England BioLabs, Ipswich, USA) and transformed into electrocompetent E. coli DH5α as described above. The plasmids were extracted using GeneJET Plasmid Miniprep (Thermo Fisher Scientific, Roskilde, Denmark) and validated by Sanger sequencing (Macrogen Europe). Next, the plasmids were transformed into E. coli MG1655 via electroporation as described above resulting in the three aminoglycoside-resistant strains: MG1655 pACYC184_ΔTet^R (CHL^R)_aph(3′)-Ia(NEO^R) (plasmid in supplementary Fig. S7 online), MG1655 pACYC184_ΔTet^R (CHL^R)_sul2_strAB(STREP^R) (plasmid in supplementary Fig. S8 online) and MG1655 pACYC184_ΔTet^R (CHL^R)_aac(3)-IV(GEN^R) (plasmid in supplementary Fig. S9 online). These E. coli strains are referred to as STREP-, GEN- and NEO-resistant strains across the manuscript.

The chemicals used in this study were purchased from Fisher Scientific (NaCl, Tris base), Amresco (KCl, ampicillin disodium salt, and kanamycin monosulfate, bacteriological agar), and Sigma-Aldrich (MgSO₄·7H₂O, CuSO₄·5H₂O, Na₂EDTA, H₃BO₃, CaCl₂·2H₂O, KH₂PO₄, NaNO₃, vitamin B₁₂, FeCl₃·6H₂O, MnCl₂·4H₂O, ZnCl₂, CoCl₂·6H₂O, RNaseZAP). Primers were synthesized by Sigma-Aldrich. GenElute Bacterial Genomic DNA kit from Sigma-Aldrich was used to isolate cyanobacterial genomic DNA. Other kits utilized in the molecular biological methods were GeneJET Plasmid Miniprep, GeneJET PCR purification, and GeneJET Gel Extraction DNA Recovery kits, FD restriction enzymes, DNA polymerases, and ligases, all purchased from Thermo-Scientific. Suppliers of all other materials used in this study are described below.