RT-qPCR was performed using the 2x QuantiTect Probe RT-PCR kit (Qiagen, Valencia, CA, USA) with the same primers and cycle times as previously described (53 (link)). All the assays were carried out in triplicate and fluorescence curves that crossed the threshold within or below 38 cycles were considered positive.
Quantitect probe rt pcr kit
Manufactured by Qiagen
Sourced in Germany, United States, Switzerland, Japan, United Kingdom, Canada
The QuantiTect Probe RT-PCR Kit is a real-time reverse transcription PCR (RT-PCR) kit designed for sensitive and reproducible detection of RNA targets. It includes a reverse transcriptase enzyme, a hot-start DNA polymerase, and optimized buffers for efficient cDNA synthesis and PCR amplification.
Automatically generated - may contain errors
Lab products found in correlation
Qiaamp viral rna mini kit, by Qiagen (45 mentions)
Rneasy mini kit, by Qiagen (34 mentions)
Trizol reagent, by Thermo Fisher Scientific (11 mentions)
Lightcycler 480 system, by Roche (9 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (9 mentions)
Rneasy kit, by Qiagen (9 mentions)
Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (9 mentions)
Lightcycler 480, by Roche (8 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (8 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (7 mentions)
Lightcycler 96, by Roche (7 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (7 mentions)
Trizol, by Thermo Fisher Scientific (7 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (6 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (6 mentions)
Cfx96 real time system, by Bio-Rad (5 mentions)
Applied biosystems 7500 fast real time pcr system, by Thermo Fisher Scientific (5 mentions)
Rneasy fibrous tissue mini kit, by Qiagen (5 mentions)
Taqman probe, by Thermo Fisher Scientific (5 mentions)
Qiaamp viral rna, by Qiagen (4 mentions)
264 protocols using quantitect probe rt pcr kit
1
RT-qPCR for SARS-CoV-2 Detection
2
Highly Sensitive RT-qPCR Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-qPCR was performed using the 2x QuantiTect Probe RT-PCR kit (Qiagen, Valencia, CA, USA) with the same primers and cycle times as previously described [36 (link)]. All the assays were performed in triplicate and fluorescence curves that crossed the threshold within or below 38 cycles were considered positive.
3
SARS-CoV-2 Detection by Quantitative RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA from NP’s supernatant was extracted using QIAamp Viral RNA (Qiagen), according to manufacturer’s instructions. Quantitative RT-PCR was performed using QuantiTect Probe RT-PCR Kit (Quiagen®) in a StepOne™ Real-Time PCR System (Thermo Fisher Scientific). Amplifications were carried out in 25 μL reaction mixtures containing 2X reaction mix buffer, 50 μM of each primer, 10 μM of probe, and 5 μL of RNA template. Primers, probes, and cycling conditions recommended by the Centers for Disease Control and Prevention (CDC) protocol were used to detect the SARS-CoV-2. Alternatively, genomic (ORF1) (gRNA) and subgenomic (ORF(sgRNAE)) were detected, as previously described (Wölfel et al., 2020 (link)). In summary, for detection of gRNA, the following primers and probe targeting for sequences downstream of the start codons of the gene E were used (E_Sarbeco_F; ACAGGTACGTTAATAGTTAATAGCGT / E_Sarbeco_R; ATATTGCAGCAGTACGCACACA / E_Sarbeco_P1; FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ); and for sgRNA detection, a leader-specific forward primer (sgLeadSARSCoV2-F; CGATCTCTTGTAGATCTGTTCTC) was used with the reverse primer and probe for gene E above mentioned, and described in (Corman et al., 2020 (link); Wölfel et al., 2020 (link)).
4
SARS-CoV-2 RNA Quantification through RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Supernatants from monocytes were harvested after 24h of SARS-CoV-2 infection and the viral RNA quantified through RT-PCR. According to manufacter’s protocols, the total RNA from each sample was extracted using QIAamp Viral RNA (Qiagen®). Quantitative RT-PCR was performed using QuantiTect Probe RT-PCR Kit (Quiagen®) in a StepOne™ Real-Time PCR System (Thermo Fisher Scientific). Amplifications were carried out containing 2× reaction mix buffer, 50 μM of each primer, 10 μM of probe, and 5 μL of RNA template in 15 μL reaction mixtures. Primers, probes, and cycling conditions recommended by the Centers for Disease Control and Prevention (CDC) protocol were used to detect the SARS-CoV-2 [55 ]. For virus quantification it was employed the standard curve method [56 (link)]. Cells of each sample were counted before the PCR analyses for normalization. The Ct values for this target were compared to those obtained to different cell amounts, 107 to 102, for calibration.
5
Quantitative RT-PCR Detection of SARS-CoV-2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA from NP’s supernatant was extracted using QIAamp Viral RNA (Qiagen), according to manufacturer’s instructions. Quantitative RT-PCR was performed using QuantiTect Probe RT-PCR Kit (Quiagen®) in a StepOne™ Real-Time PCR System (Thermo Fisher Scientific). Amplifications were carried out in 25 µL reaction mixtures containing 2X reaction mix buffer, 50 µM of each primer, 10 µM of probe, and 5 µL of RNA template. Primers, probes, and cycling conditions recommended by the Centers for Disease Control and Prevention (CDC) protocol were used to detect the SARS-CoV-2. Alternatively, genomic (ORF1) (gRNA) and subgenomic (ORF(sgRNAE)) were detected, as previously described (Wölfel et al., 2020 (link)). In summary, for detection of gRNA, the following primers and probe targeting for sequences downstream of the start codons of the gene E were used (E_Sarbeco_F; ACAGGTACGTTAATAGTTAATAGCGT / E_Sarbeco_R; ATATTGCAGCAGTACGCACACA / E_Sarbeco_P1; FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ); and for sgRNA detection, a leader-specific forward primer (sgLeadSARSCoV2-F; CGATCTCTTGTAGATCTGTTCTC) was used with the reverse primer and probe for gene E above mentioned, and described in (Corman et al., 2020 (link), Wölfel et al., 2020 (link)).
6
Quantitative PCR for Zika Virus Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative PCR (qPCR) was performed according to established methodologies [13 (link)]. Briefly, we used the QuantiTect Probe RT-PCR Kit (Qiagen) reagents and the CFX96 Real-Time System (Bio-Rad) where each 25 μL PCR reaction contained 12.5 μL 2X QuantiTect PCR mastermix, 1 μL of each 10 mM primer, 0.5 μL 0.2 mM probe, 0.5 μL reverse transcriptase, 3 μL RNA template and 6.5 μL H2O. Every PCR was performed as follows: reverse transcription at 50°C for 30 min, initial PCR activation at 95°C for 5 min and 45 amplification cycles consisting of a 95°C denaturation for 10 sec and a 60°C annealing/extension for 30 sec. Sequences of primers and probes are as follows; ZIKV-F: 5'- TGG TCA TGA TAC TGC TGA TTG C -3', ZIKV-R; 5'- CCT TCC ACA AAG TCC CTA TTG C -3', ZIKV-probe5'- /56-FAM/CGG CAT ACA GCA TCA GGT GCA TAG GAG /3BHQ_1/ -3', Vero (African green monkey) GAPDH-F:5′- GGG TGT GAA CCA TGA GAA GTA T-3′, GAPDH-R; 5′- GAG TCC TTC CAC GAT ACC AAA G-3′ and GAPDH-probe: 5'- /5HEX/AC AAC AGC CTC AAG ATC GTC AGC A/3BHQ_1/ -3'. The relative amount of viral transcript to GAPDH was calculated using the 2-ΔΔCT method. Data were expressed as fold change RNA compared to the control.
7
Quantitative RT-PCR for HEV RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nucleic acids were extracted from 200 μL serum by the Qiamp MinElute Virus Spin kit (QIAGEN). HEV RNA quantification was carried out by an in house Real-Time PCR method, using previously reported primers [16 (link)]. A 70 bp region of the ORF3 (position 5261–5330 on full length HEV genome sequence Acc.N. M73218) was amplified from 7 μL RNA extract (equivalent to RNA extracted from 35 μL serum). Amplification was carried out on the Rotor-Gene Q 5plex Platform (QIAGEN, Hilden, Germany) by the QuantiTect Probe RT-PCR kit (QIAGEN, Hilden, Germany). Data were analysed by the Rotor-Gene Q software, Version 2.1.0 (Build 9). The analytical sensitivity of the validated method is 35–40 IU/mL HEV RNA (95% detection limit).
8
Comparative SARS-CoV-2 RT-PCR Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An in-house SARS-CoV-2 RT-PCR protocol and a commercial RT-PCR kit were used for method comparison. Since both assays work only with purified RNA, the above-mentioned RNA isolation procedure was mandatory prior to PCR testing.
The in-house PCR protocol was based on the QuantiTect Probe RT-PCR Kit (Qiagen, Hilden, Germany) with primers and a hydrolysis probe (Biomers, Ulm, Germany) targeting the E gene. Detection was done on the FAM channel of a LightCycler 96 instrument (Roche, Basel, Switzerland). Primer sequences and the temperature profile are shown in the appendix (Supplementary Information1 ).
For comparison of the SARS-CoV-2 RT-LAMP protocol with a commercial kit, the LABSYSTEMS COVID-19 Real Time Multiplex RT-PCR Kit (Labsystems Diagnostics OY, Helsinki, Finland) was used. This kit is designed to detect three genes (ORF1ab, E, N) of the SARS-CoV-2 genome simultaneously. The RT-PCR reactions were set up according to the manufacturer’s protocol and were analysed on a Rotor-Gene Q instrument.
The in-house PCR protocol was based on the QuantiTect Probe RT-PCR Kit (Qiagen, Hilden, Germany) with primers and a hydrolysis probe (Biomers, Ulm, Germany) targeting the E gene. Detection was done on the FAM channel of a LightCycler 96 instrument (Roche, Basel, Switzerland). Primer sequences and the temperature profile are shown in the appendix (Supplementary Information
For comparison of the SARS-CoV-2 RT-LAMP protocol with a commercial kit, the LABSYSTEMS COVID-19 Real Time Multiplex RT-PCR Kit (Labsystems Diagnostics OY, Helsinki, Finland) was used. This kit is designed to detect three genes (ORF1ab, E, N) of the SARS-CoV-2 genome simultaneously. The RT-PCR reactions were set up according to the manufacturer’s protocol and were analysed on a Rotor-Gene Q instrument.
9
SARS-CoV-2 RT-PCR Detection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT–PCR used targets in the open reading flame 1a (ORF1a) and spike (S) of SARS-CoV-2 according to the guideline [24 (link)] from the National Institute of Infectious Diseases in Japan. Total RNA was extracted using an EZ1 Virus Mini Kit v2.0 (Qiagen, Tokyo, Japan) according to the manufacturer’s instructions. RT-PCR was performed using a QuantiTect Probe RT-PCR Kit (Qiagen) and an N2 primer set.
10
SARS-CoV-2 RNA Quantification via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The SARS-CoV-2 RNA copy number was quantified in RNA samples extracted from infected cells using the QuantiTect probe RT-PCR Kit (QIAGEN). We prepared a standard curve using the ORF9 nucleoprotein coding sequence cloned in pcDNA3. 10 μg of plasmid was linearised with Apa1 at 37°C for 2 h. DNA was purified with the PCR cleanup kit from QIAGEN, and 1 μg of DNA was used in a T7 transcription reaction using Promega T7 RiboMAX (P1320) at 37°C for 30 min. The transcribed RNA was cleaned using Zymo RNA clean and concentrator 25 (R1017; Zymo Research). The copy number was derived using an online calculator (https://nebiocalculator.neb.com/ ssRNA mass to moles converter).
The RNA standard curve was prepared from diluting RNA template from 10 × 108 to 10 × 101 in RNase-free water. RNA samples were diluted 1:5,000, and 1 μl of standard or sample was dispensed into each well of a 384-well plate to perform the RT-PCR step following manufacturer’s instructions. Quantitation of the copy number was performed using N1 and N2 standard probes for SARS-CoV-2 (IDTDNA).
The RNA standard curve was prepared from diluting RNA template from 10 × 108 to 10 × 101 in RNase-free water. RNA samples were diluted 1:5,000, and 1 μl of standard or sample was dispensed into each well of a 384-well plate to perform the RT-PCR step following manufacturer’s instructions. Quantitation of the copy number was performed using N1 and N2 standard probes for SARS-CoV-2 (IDTDNA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!