RNA was harvested using the TRIzol reagent (Invitrogen), according to the manufacturer’s guidelines. The RNA was transcribed into cDNA by miscriptreverse transcription kit (Takara, Japan). The level of mRNA was quantified by q-PCR with the QuantiTect SYBR Green PCR kit (Takara, Japan). The reaction conditions were 95°C for 10 min, followed by 95°C for 15 s for 40 cycles, and 60°C for 60 s. Primers used for PCR were as follows: CUX1-forward: 5′-AGCCGAAACCATAGCTCTTGA-3′; CUX1-reverse: 5′-GCCCTTTCGAGGTCCGTCAT-3′; GAPDH-forward: 5′- TGCACCACCAACTGCTTAGC-3′; GAPDH-reverse: 5′-GGCA TGCACTGTGGTCATGAG-3′. The mRNA level of target genes was compared to GAPDH by qPCR using the comparative cycle threshold (2–ΔΔCT) method. All assays were independently performed in triplicate.
Quantitect sybr green pcr kit
Manufactured by Takara Bio
Sourced in Japan, China, United States
The QuantiTect SYBR Green PCR Kit is a real-time PCR kit that enables quantitative detection of DNA sequences using the SYBR Green fluorescent dye. The kit includes a ready-to-use master mix and provides all the necessary reagents for efficient PCR amplification and quantification.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (19 mentions)
Trizol reagent, by Takara Bio (9 mentions)
Reverse transcription kit, by Takara Bio (8 mentions)
Primescript rt reagent kit, by Takara Bio (8 mentions)
Trizol, by Thermo Fisher Scientific (5 mentions)
Cfx manager software 3, by Bio-Rad (4 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (4 mentions)
Quantstudio 1, by Thermo Fisher Scientific (4 mentions)
Stem loop primers, by RiboBio (3 mentions)
Stratagene mx3000p, by Agilent Technologies (3 mentions)
Miscript reverse transcription kit, by Takara Bio (2 mentions)
Taq polymerase, by Takara Bio (2 mentions)
Trizol total rna isolation reagent, by Thermo Fisher Scientific (2 mentions)
Superscript 3 reverse transcriptase kit, by Thermo Fisher Scientific (2 mentions)
Relative quantification software version 1, by Roche (2 mentions)
Lightcycler 2, by Roche (2 mentions)
Rnaiso plus, by Takara Bio (2 mentions)
Hairpin it mirnas qpcr quantitation kit, by GenePharma (2 mentions)
Taqman rt reagents kit, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
51 protocols using quantitect sybr green pcr kit
1
RNA Extraction and qPCR Analysis of CUX1 Expression
2
AAV-6-Mediated miR-21-5p Overexpression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AAV-6-miR-21-5p-GFP [miR-21-5p mimic (UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA) and green fluorescent protein (GP) encoded in an adeno-associated virus (AAV) type 6 vector] and AAV-6-miR-21-5p negative control (only GFP encoded in the AAV-6 vector) were from Synthgene Biotechnology Co., Ltd. Primers used for reverse transcription-quantitative PCR (RT-qPCR) experiments were from Thermo Fisher Scientific, Inc. Fetal bovine serum (FBS), DMEM/F12 and DMEM-low glucose medium (Gibco; Thermo Fisher Scientific, Inc.), Annexin V-FITC/propidium iodide (PI) cell apoptosis detection kit (BD Biosciences), QuantiTect SYBR Green PCR kit (Takara Bio, Inc.), HiScript® II 1st Strand cDNA Synthesis kit (Vazyme), bicinchoninic acid (BCA) protein quantification kit and SDS-PAGE gel preparation kit (Beyotime Institute of Biotechnology) were utilized in the present study. Antibodies targeting PTEN (cat. no. ab32199), AKT (cat. no. ab8805), phosphorylated (p) AKT (cat. no. ab38449), and GAPDH (cat. no. ab181602), and the secondary horseradish peroxidase (HRP)-labeled antibody, were from Abcam. The unlisted reagents were of analytical grade.
3
Quantifying Gene and MicroRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from frozen tissues or cultured cells using TRIzol total RNA isolation reagent (Invitrogen) according to the manufacturer’s instructions. cDNA was synthesized from total RNA or purified small RNAs using gene-specific primers or random hexamers with the SUPERSCRIPT III Reverse Transcriptase Kit (Invitrogen), according to the manufacturer’s instructions. PCR was then performed using Taq polymerase (TaKaRa) with the specific primers for TGFBR1 (forward: 5′- TCGTCTGCATCTCACTCAT-3′, reverse: 5′-GATAAATCTCTGCCTCACG-3′) and GAPDH as an internal control (forward: 5′-TCTCTGCTCCTCCTGTTC-3′, reverse: 5′-GGTTGAGCACAGGGTACTTTATTGA-3′). MicroRNAs were detected with stem-loop primers purchased from RiboBio as described (Guangzhou RiboBio Co., Ltd). GAPDH and U6 small nucleolar RNA were used for normalization. qPCR was conducted using a QuantiTect SYBR Green PCR Kit (TaKaRa Bio Inc., Japan) on a StepOne Real-Time PCR System (Applied Biosystems, CA, USA). Relative expression levels were calculated using the 2–ΔΔCt method (Bio-Rad CFX manager software 3.1).
4
Quantifying TROAP mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was harvested using the Trizol reagent (Invitrogen), according to the manufacturer's guidelines. The RNA was transcribed into cDNA by miscriptreverse transcription kit (Takara). The level of mRNA was quantified by q‐PCR with the QuantiTect SYBR Green PCR kit (Takara). The following primers were used: TROAP forward: 5‐CCTCCGGGGTGTATCTCCTAC‐3; reverse: 5‐ACGGCGCACGATGTAACAG‐3; GAPDH forward: 5‐TGACTTCAACAGCGACACCCA‐3; reverse: 5‐CACCCTGTTGCTGTAGCCAAA‐3. The expression of TROAP mRNA was normalized to GAPDH mRNA.
5
Gene Expression Analysis in T-cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNA levels of PI3K, AKT, mTOR, mTORC1, p70S6K, GATA3, and Foxp3 were determined using the Quantitect™ SYBR green PCR Kit (Takara, Kyoto, Japan) and LightCycler® 2.0 (Roche Molecular Biochemicals, Basel, Switzerland) using established primers [Table 2 ]. The second derivative maximum method was used to quantify cDNA levels (LightCycler version 3.5.30; Roche Molecular Biochemicals). The level of each target gene was expressed after normalization to GAPDH (Relative Quantification Software version 1.0; Roche Molecular Biochemicals).
6
Cardiac gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared from the left ventricle of the heart using TRIzol (Life Technologies, Grand Island, NY, USA). Complementary DNA (cDNA) was synthesized using the First-Strand cDNA Synthesis Kit (Takara Bio Inc., Kusatsu, Shiga, Japan) in accordance with the manufacturer’s instructions. RT-qPCR was carried out in 20 µl system with the QuantiTect SYBR Green PCR Kit (Takara Bio Inc., Kusatsu, Shiga, Japan) on an ABI StepOneTM Real-Time PCR System (Thermo Fisher Scientific Inc., Waltham, MA, USA). The primer sequences used were as follows: natriuretic peptide A (Nppa), 5’-ACCCTGGGCTTCTTCCTCGTCTT-3’ (sense) and 5’-GCGGCCCCTGCTTCCTCA-3’ (anti-sense); β-myosin heavy chain (Myh7), 5’-GCCCTTTGACCTCAAGAAAG-3’ (sense) and 5’-CTTCACAGTCACCGTCTTG-3’ (anti-sense); and Gapdh, 5’-AGGTCGGTGTGAACGGATTTG-3’ (sense) and 5’-GGGGTCGTTGATGGCAACAA-3’ (antisense). Gapdh was used for normalization of the qPCR. The fold change in expression was calculated using the 2−△△CT method.
7
Quantification of mRNA Expression in Pancreatic Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Next, the qRT-PCR experiment was performed on six PC patients, from whom the PC tissue and para-PC tissue were taken for mRNA quantification. These six patients were enrolled between June 2021 and October 2021 in Fuyang Hospital affiliated with Anhui Medical University. All of them signed informed consent forms. This study was approved by the Ethics Committee of the Fuyang Hospital affiliated with Anhui Medical University. The total cellular RNAs were isolated from cells using the TRIzol reagent (Invitrogen, Carlsbad, CA, United States), according to the manufacturer’s instructions. The reverse transcription was conducted using the reverse transcription kit provided by TaKaRa (Otsu, Shiga, Japan). Real-time polymerase chain reaction (RT-PCR) was performed using a QuantiTect SYBR Green PCR Kit (TaKaRa) and on an Applied Biosystems QuantStudio 1 system (Thermo, Waltham, MA, United States). Relative quantification was determined using the 2−ΔΔCt method. The relative expression of messenger RNA (mRNA) for each gene was normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. The specific primer sequences adopted in this experiment are summarized in Supplementary Table S2 .
8
Quantitative RT-PCR Analysis of NgBR Expression
9
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNAs were extracted from cells utilizing Trizol Reagent (Invitrogen, Carlsbad, CA, United States) adhering to the protocol provided by the manufacturer. The reverse transcription was carried out utilizing the reverse transcription kit from Takara (Otsu, Shiga, Japan). Subsequently, real-time polymerase chain reaction (RT-PCR) was conducted utilizing a QuantiTect SYBR Green PCR Kit from Takara, and on an Applied Biosystems QuantStudio 1 (Thermo, Waltham, MA, United States). Relative quantification was determined using the −2ΔΔCt method. The expression levels of mRNA for each gene were normalized against the expression level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA to obtain relative expression values. The primers were synthesized by GenePharma Inc. (Shanghai, China), the sequence of which were listed in Supplementary Table 1 . *P < 0.05, **P < 0.01.
10
qRT-PCR Analysis of miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA extracts were processed with the reverse transcription (RT) reactions to enable the subsequent quantitative polymerase chain reaction (qRT-PCR), which worked with the StepOnePlus real-time system (Applied Biosystems, USA). In the present study, the internal controls included GAPDH and U6. miRNAs were detected with stem-loop primers purchased from RiboBio (China) as described. GAPDH and U6 small nucleolar RNA were used for normalization. qPCR was conducted using a QuantiTect SYBR Green PCR kit (TaKaRa Bio, Japan) on a StepOne real-time PCR system (Applied Biosystems, USA). Relative expression levels were calculated using the 2−ΔΔCt method (Bio-Rad CFX manager software 3.1). All of the primers are listed in Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!