E coli bl21

We placed 100 μl E. coli BL21 (TIANGEN, China) into an ice bath and added 1 ng Pet-14b-EGFR plasmid (Public Protein/Plasmid Library, China), which was followed by a water bath at 42°C for 60 s, followed by an ice bath for 3 min, and finally added 900 μl of LB medium. After mixing, we placed the mixture in a shaking bed at 37°C and incubated for 45 min at 150 rpm/min. After shaking, 100 μl of liquid containing kanamycin was evenly coated on the LB solid medium, and the plate was inverted and cultured overnight at 37°C. On the following day, the monoclonal bacteria were selected and cultured in the LB medium containing kanamycin at 200 rpm/min in a shaking bed at 37°C for 12 h.

Using the T. spiralis cDNA generated in our laboratory as a template, the TPD52 gene was amplified by PCR and inserted into pET-32a vector to construct a recombinant plasmid pET-32a-TPD52. Primers are shown in Table 1. The recombinant plasmid was transformed into E. coli BL21 (Tiangen Biotech, Beijing, China). After inducing expression with IPTG and purification by Ni purification column, the fusion protein TPD52 was identified using HRP-conjugated 6× His tag antibody (HRP-66005, Proteintech, Wuhan, China) and mouse anti-T. spiralis antiserum. The fusion protein TPD52 concentration was determined using a BCA assay. Mice were inoculated subcutaneously with 100 μg of fusion protein TPD52 emulsified in CFA and boosted after 2 and 3 weeks. The serum antibody titre was measured by ELISA and its concentration was determined using a BCA assay.Table 1

Primer sequences employed in this study

Primer	Primer sequences (5′ → 3′ direction)	Usage
P1	ATACGACTCACTATAGGGCGAATTGGC	cDNA amplification
P2	CTCGGGAAGCGCGCCATTGTGTTGGT
P3	AGTACTATGGAGAATCGAACTACAGAA	TPD52 amplification
P4	TCTAGATCATTCAAATTTGTTTTCTAC

Italicized sequences represent the restriction sites ScaI and XbaI

Recombinant constructs were made using gene recombination technology. E. coli DH5α (TIANGEN, China) was used for cloning of recombinants and E. coli BL21 (TIANGEN, China) was used to express the proteins encoded-fragments inserted in the expression vectors pET-28a. E. coli strains were cultured in Luria–Bertani (LB) medium with kanamycin (50 μg/mL) as needed. APP strains were cultured in Trypticase Soy Agar (TSA) or Trypicase Soy Broth (TSB) (DIFCO Laboratories, USA) with 10% (v/v) fetal calf serum (FBS; SIJIQING, China) and nicotinamide adenine dinucleotide (NAD; 15 μg/mL) at 37°C. APP L20 (serovar 5b reference strain) was purchased from the China Institute of Veterinary Drug Control (Beijing, China).

Silkworms (Dazao) were reared with fresh mulberry leaves at 25 °C under 14 h light/10 h dark cycle. BmN cells derived from B. mori ovary were cultured at 28 °C in Grace’s Insect Medium (Sigma-Aldrich, MO, USA, G9771) supplied with 10% heat-inactivated fetal bovine serum (AusGeneX, Molendinar, Australia, FBS500-S); HEK293 cells (ATCC, CRL-1573^TM) were cultured in DMEM medium (Thermo Fisher, MA, USA, 10569044) supplemented with 5% fetal bovine serum. Escherichia coli DH5α (TIANGEN, Beijing, China, CB101-03) was used for subcloning, and E. coli BL21 (TIANGEN, Beijing, China, CB105-02) was used for prokaryotic expressions of proteins.

The extremely thermophilic cellulolytic bacteria C. owensensis DSM 13,100 was purchased from the DSMZ (German Collection of Microorganisms and Cell Cultures). The substrates, p-nitrophenyl β-d-galactopyranoside (pNPGal), p-nitrophenyl β-d-glucopyranoside (pNPGlu), p-nitrophenyl β-d-cellobioside (pNPC), p-nitrophenyl β-d-xylopyranoside (pNPX), p-nitrophenyl β-d-mannopyranoside (pNPM), p-nitrophenyl α-l-arabinofuranoside (pNPAr), carboxymethylcellulose (CMC), locust bean gum, and synanthrin, were purchased from Sigma. The chemicals and other substrates were purchased from Sinopharm Chemical Reagent Beijing Co., Ltd or Sigma. The steam-exploded corn straw was obtained by being pretreated in the condition of 1.5 MPa retained for 3 min. Its composition was glucan 46.8 %, xylan 4.3 %, araban 0 %, and lignin 27.4 %. Competent cells used for cloning and expression were Escherichia coli Top10 (TianGen, China) and E. coli BL21 (DE3), respectively. The E.coli BL21 (DE3) competent cells were prepared with the methods described in Molecular Cloning: A Laboratory Manual [43 ].