Synergy ht reader

Renin enzymatic activity from EDTA-aprotinin supplemented mouse plasma samples (described in the Section 4.2) were measured in a 96-well microplate (Synergy HT reader and Gen5 v1.09 software, BioTek Instruments, Inc., Winooski, VT, USA) and quantified using exogenous fluorescence resonance transfer (FRET) peptide substrates of renin FRET-QXL™520/5-FAM, optimized for mouse renin (SensoLyte 520 mouse renin assay kit, AnaSpec, Fremont, CA, USA) as previously reported [25 (link),27 (link),32 (link),78 (link),79 (link),80 (link),81 (link)]. Cleavage of the FRET substrate by mouse renin results in the recovery of quenched fluorescence of 5-FAM, which was detected at excitation/emission = 490/520 nm with minimum autofluorescence of plasma samples. The 5-FAM fluorescent reference standard curve was used for results quantification. It is important to note that the plasma renin activity concentration assay differs from plasma renin activity (PRA) and active renin concentration (ARC)/ active plasma renin concentration (APRC) which have been historically used to report active renin in clinical trials [32 (link)].

Total RNA was isolated using the miRNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The subsequent quantification and quality control were performed with the Synergy HT Reader (BioTek, Winooski, VT, USA). For miRNA quantification, specific TaqMan MiR Assays were used following the manufacturer’s protocol (Thermo Fisher, Dreieich, Germany, assay IDs: 000391 for miR-16-5p, 002308 for miR-17-5p and 000377 for let-7a-5p). MiRNAs were quantified using the ViiA™ 7 Real-Time PCR System (Life Technologies, Carlsbad, USA). MiRNA levels were normalized to the Small nucleolar RNA SNORD48 (RNU48, Thermo Fisher, Dreieich, Germany, assay ID: 001006).

ATP content of MIA PaCa-2 and PANC-1 cells (seeded overnight at 1 × 10⁵ cells/ml) was determined after metabolic inhibitor treatment using a ViaLight Plus kit (Lonza) and a Synergy HT reader (BioTek). Experiments were run in duplicate. Background luminescence values from a positive control (ATP depletion mixture: 10 μm OM, 4 μm carbonyl cyanide m-chlorophenyl hydrazine, 2 mm IAA, and 500 mm BrPy) were subtracted from all values before normalizing to untreated control (%). Comparisons between groups were performed using a Kruskal-Wallis test with a post hoc Dunn's test.

Luciferase reporter assay to validate miR-26a-5p binding to human PIK3C2A and VEGF-A was done in HEK cells applying the luciferase assay aystem (Promega, E1500, Madison, WI, USA.). At first, primers to amplify 3′-UTR of VEGF-A and PIK3C2A were designed, carrying 5′-SpeI and 3′-HindIII restriction sites to ligate amplicon of target 3′-UTR into the pmirReport vector. Primer design for VEGF-A 3′UTR were forward 5′-AAA ACT AGT ACAGAGAGACAGGGCAGGAT-3′ and reverse 5′-AAA AAG CTT TGCACTAGAGACAAAGACGTGA-3′. Primers to amplify 3′-UTR of PIK3C2A were designed, carrying 5′-SpeI and 3′-HindIII restriction sites to ligate amplicon of target 3′-UTR into the pmirReport vector. Primer design was PIK3C2A_3′UTR_fwd: AAA ACT AGT AGAATCGCTTGAACCCAGGA and PIK3C2A_3′UTR_rev: AAA AAG CTT ACGACCTCTACCAAGACAGT. MiR-26a-5p mimic (30 nM, 50 nM and 100 nM), pmiR-report-3′-UTR and beta-Gal normalizing plasmid (20 ng) were transfected to HEK293 cells. Cells were lysed 24 h after transfection and subsequently used for luciferase activity and beta-Gal activity measurement applying Synergy HT reader (Biotek, Germany). Luciferase reads are normalized with beta-Gal reporter expression values according to manufacturers’ instructions (beta-Gal kit system, Promega, E1500, Madison, WI, USA).

Viral polymerase activity was assessed using an experimentally optimized minigenome assay with viral polymerase expression vectors (VPOL: pCAGGS-NP and pCAGGS-PB1, −PB2, and -PA, in a 5:2:1:2 ratio), a vRNA firefly luciferase reporter construct (minigenome), and Renilla luciferase expression plasmid as an internal transfection control, as we described previously [7 (link)]. A549 cells were transfected with esiRNA and incubated for 36 hours. Cells were then transfected with VPOL, minigenome, and Renilla plasmids, using the FuGENE HD transfection reagent (Promega), following the manufacturer’s recommendations. 24 hours after the second transfection, cells were harvested and assayed using the Dual Luciferase Reporter Assay (Promega) on a BioTek Synergy HT reader.