Streptavidin sepharose

DNA methylation at selected sites was validated in a subset of the original cohort by the bisulfite pyrosequencing. This subset consisted of 47 male subjects ages 6 to 21. One microgram of human genomic DNA was sodium bisulfite converted using the EZ DNA Methylation kit (Zymo Research) according to the manufacturer’s guidelines. Pyrosequencing was performed using the PyroMark MD system (Qiagen, Valencia, CA) according to the manufacturer’s protocol. Briefly, the PCR was performed with 10 μM primers, one of which was biotinylated for later purification by Streptavidin Sepharose (VWR). The oligonucleotide primers were purchased from IDT and used for the amplified region of DDO: the forward primer, TGTTTAGGAGAAAGGAGTAAGTGATT; the reverse biotinylated primer, ACCCATTATTCACCATACCTACAA; and the pyrosequencing primer, TTTTATGGAGTTGTTTTTGTTAAG. Sepharose beads containing the PCR product were washed and purified using 0.2 M NaOH and the Pyrosequencing Vacuum Prep Tool (QIAGEN). Five microliters of the PCR products was sequenced, and methylation was quantified using the provided software (QIAGEN).