The miR‐181a‐5p or YY1 expression in mast cells, HTR‐8/SVneo cells or exosomes was quantitated by qRT‐PCR. RNA collections from cells were performed using TRIzol (15596026; Invitrogen). Total RNA from exosomes was harvested using Total Exosomal RNA & Protein Isolation Kit (4478545; Invitrogen). Subsequently, reverse transcription of total RNA was completed by RevertAid first strand cDNA synthesis kit (K1621; Thermo Scientific) or microRNA reverse transcription kit (4366597; Applied Biosystems). LightCycler 480II (Roche) and FastStart SYBR Green Premix (FSSGMMRO; Roche) were employed to run the real‐time PCR reaction. GAPDH and U6 were served as internal control genes. The universal reverse miRNA primers were obtained from TaqMan™ MicroRNA Assay (4440888; Applied Biosystems). MiR‐181a‐5p forward (F) primer is AACATTCAACGCTGTCGGTGAGT, and U6 primer (5′‐3′) is CTCGCTTCGGCAGCACA, AACGCTTCACGAATTTGCGT. Primer sequences of YY1 and GAPDH are as follows (5′‐3′): YY1: ACGGCTTCGAGGATCAGATTC, TGACCAGCGTTTGTTCAATGT; GAPDH: ACAACTTTGGTATCGTGGAAGG, GCCATCACGCCACAGTTTC.
Faststart sybr green premix
Manufactured by Roche
FastStart SYBR Green Premix is a ready-to-use solution for real-time PCR analysis. It contains all the necessary components, including SYBR Green I dye, for the amplification and detection of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Microrna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Total exosomal rna protein isolation kit, by Thermo Fisher Scientific (1 mentions)
Taqman microrna assay, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Lightcycler 480 2, by Roche (1 mentions)
First strand cdna synthesis rt pcr kit, by Roche (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
2 protocols using faststart sybr green premix
1
Quantifying miR-181a-5p and YY1 Expression
2
Quantifying mRNA Levels in BALF
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs in BALF were collected by using TRIzol reagent (T9424-25ML; Sigma), and 2-μg total RNA sample was applied to reverse-transcribed into complementary DNA (cDNAs) with RT-PCR first strand cDNA synthesis kit (11483188001; Roche, Switzerland) according to manufacturer's protocol. qRT-PCR was conducted by incubating cDNAs with FastStart SYBR Green premix (4673484001; Roche). The mRNA level of specific genes was determined by employing 2 -ΔΔCt method. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) level was regarded as normalization. The primer sequences are listed in Table 1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!