Log In Sign up
The largest database of trusted experimental protocols

Tead1

Manufactured by BD
Visit Supplier
Sourced in United States

TEAD1 is a laboratory instrument used for the analysis and quantification of biochemical components. It utilizes advanced spectroscopic techniques to measure the concentration of specific molecules or analytes within a sample. The core function of TEAD1 is to provide accurate and reliable data for research and diagnostic applications.

Automatically generated - may contain errors

Lab products found in correlation

Sox10, by R&D Systems (2 mentions) Chip it express kit, by Active Motif (2 mentions) Chromatin ip dna purification kit, by Active Motif (2 mentions) Nitrocellulose membrane, by Merck Group (2 mentions) Vgll4, by Novus Biologicals (2 mentions) Menin, by Abcam (2 mentions) Myc tag, by Cell Signaling Technology (2 mentions) Ne per nuclear and cytoplasmic extraction reagent, by Thermo Fisher Scientific (1 mentions) Ecl prime western blotting detection reagent, by Cytiva (1 mentions) P yap, by Cell Signaling Technology (1 mentions) Complete lysis m buffer, by Roche (1 mentions) β actin, by Cell Signaling Technology (1 mentions) Lamin a c, by Cell Signaling Technology (1 mentions)

Spelling variants of this product

Anti-TEAD1 (2 citations) Anti-TEAD1 antibody (2 citations) TEAD1 clone 610923 (2 citations) Mouse-TEAD1 (2 citations) Mouse α-TEAD1 (1 citations)

7 protocols using tead1

1

ChIP-seq analysis of transcription factors

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP was carried out as described previously 25 (link), 57 (link) with the following antibodies: goat IgG (Santa Cruz Biotechnology, sc-2028), Sox10 (R&D, AF2864), and Tead1 (BD Biosciences, 610923). Primers used included the following:
Tekt3 +7.8kb (Forward: aataccagcagatccggaagac, Reverse: ttgactcgttctcccaggtttt),
Itga6 −22.8kb (Forward: tgcttctgataagccccaac, Reverse: aagtcccagacacgtccttg),
Itga6 −20.6kb (Forward: tggaggcagaaggagaaaaa, Reverse: aggggcctgttaggaacact),
Itga6 −16.2kb (Forward: gacttgagctgtctgcatgg, Reverse: tggactgactaggcttccaca),
Itga6 −8.5kb (Forward: aaaagccaaacaaacccaga, Reverse: ggctagggcaagctaaggat),
Itga6 −7.8kb (Forward: tgcttttggtcatgtggttg, Reverse: accactggctagctcagcat),
Itga6 −165bp (Forward: tcgataaaacgccggagagt, Reverse: gtagctagcagccgctcaat),
Dag1 +3kb (Forward: atgaacccctcttcctgacc, Reverse: ccttgctgagactgtgctca),
Dag1 −36kb (Forward: ggatggaagactgaaaggcc, Reverse: ccctttccctctggtgtgag).
Poitelon Y., Lopez-Anido C., Catignas K., Berti C., Palmisano M., Williamson C., Ameroso D., Abiko K., Hwang Y., Gregorieff A., Wrana J., Asmani M., Zhao R., Sim F., Wrabetz L., Svaren J, & Feltri M. (2016). YAP and TAZ control peripheral myelination and the expression of laminin receptors in Schwann cells. Nature neuroscience, 19(7), 879-887.
+ Open protocol
+ Expand
2

ChIP Assay for Histone Modifications

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP assays were performed using the ChIP-IT® Express Kit (Active Motif). 10 μg of sonificated chromatin extract was incubated with antibodies against H3K27me3, H3K27ac, H3K9me3, H3K4me1, H3K4me3 (no. 39155, 39297, 39161, 39135, 39915 all from Active Motif), PU.1, Smad3 (no. 2266, 9523 both from Cell Signaling Technology, Danvers, USA) and TEAD1 (no. 610923 from BD Biosciences) or normal rabbit or mouse IgG antibody (no. sc-2027 X, sc-2025, both from Santa Cruz Biotechnology). Purification was performed using the Chromatin IP DNA Purification Kit (Active Motif) and bound sequences were determined by quantitative real-time PCR using primers listed in supplementary table.
Wohlfahrt T., Rauber S., Uebe S., Luber M., Soare A., Ekici A., Weber S., Matei A.E., Chen C.W., Maier C., Karouzakis E., Kiener H.P., Pachera E., Dees C., Beyer C., Daniel C., Gelse K., Kremer A.E., Naschberger E., Stürzl M., Butter F., Sticherling M., Finotto S., Kreuter A., Kaplan M.H., Jüngel A., Gay S., Nutt S.L., Boykin D.W., Poon G.M., Distler O., Schett G., Distler J.H, & Ramming A. (2019). SPI1/PU.1 controls fibroblast polarization and tissue fibrosis. Nature, 566(7744), 344-349.
+ Open protocol
+ Expand
3

Western Blot Analysis of Cellular Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total proteins were isolated using complete Lysis-M buffer (Roche). The protein concentration was measured using the ND-1000 method (Thermo Fisher Scientific). Equal amounts of protein lysates were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred using the iBot® Blotting System (Invitrogen). The membranes were blocked for 1 h at room temperature with a buffer containing 2% bovine serum albumin in Tris-buffered saline with 0.1% Tween-20. The membranes were incubated overnight in the diluted antibodies and blocked with secondary immunoglobulin G (IgG) antibody for 1 h. Specific proteins were detected using the ECL prime western blotting detection reagent (Amersham Biosciences, Buckinghamshire, UK). The monoclonal/polyclonal antibodies, including PARP, MDR1, YAP1 (= YAP, YAP65), p-YAP, TAZ, β-actin, Lamin A/C (Cell Signaling Technology), MOB1B (= MOB4A, Abgent), and TEAD1 (BD Biosciences, city, US state, country), were used. Nuclear and cytoplasmic fractions were prepared using the NE-PER Nuclear and Cytoplasmic Extraction reagents based on the manufacturer’s instruction (Thermo Fisher Scientific).
Matsuda Y., Narita S., Nara T., Mingguo H., Sato H., Koizumi A., Kanda S., Numakura K., Saito M., Inoue T., Hiroshima Y., Nanjo H., Satoh S., Tsuchiya N, & Habuchi T. (2020). Impact of nuclear YAP1 expression in residual cancer after neoadjuvant chemohormonal therapy with docetaxel for high-risk localized prostate cancer. BMC Cancer, 20, 302.
+ Open protocol
+ Expand
4

ChIP Assay for Histone Modifications

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP assays were performed using the ChIP-IT® Express Kit (Active Motif). 10 μg of sonificated chromatin extract was incubated with antibodies against H3K27me3, H3K27ac, H3K9me3, H3K4me1, H3K4me3 (no. 39155, 39297, 39161, 39135, 39915 all from Active Motif), PU.1, Smad3 (no. 2266, 9523 both from Cell Signaling Technology, Danvers, USA) and TEAD1 (no. 610923 from BD Biosciences) or normal rabbit or mouse IgG antibody (no. sc-2027 X, sc-2025, both from Santa Cruz Biotechnology). Purification was performed using the Chromatin IP DNA Purification Kit (Active Motif) and bound sequences were determined by quantitative real-time PCR using primers listed in supplementary table.
Wohlfahrt T., Rauber S., Uebe S., Luber M., Soare A., Ekici A., Weber S., Matei A.E., Chen C.W., Maier C., Karouzakis E., Kiener H.P., Pachera E., Dees C., Beyer C., Daniel C., Gelse K., Kremer A.E., Naschberger E., Stürzl M., Butter F., Sticherling M., Finotto S., Kreuter A., Kaplan M.H., Jüngel A., Gay S., Nutt S.L., Boykin D.W., Poon G.M., Distler O., Schett G., Distler J.H, & Ramming A. (2019). SPI1/PU.1 controls fibroblast polarization and tissue fibrosis. Nature, 566(7744), 344-349.
+ Open protocol
+ Expand
5

Comprehensive Western Blotting Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blotting was performed as described.5 (link) Briefly, cell protein samples were prepared in ice-cold lysis buffer (100 mmol/L TrisHCl pH7.4, 10 mmol/L NaCl, 1 mmol/L EDTA, 1 mmol/L EGTA, 10% glycerol, 0.5% deoxycholate, 1% Triton X-100, 0.1% SDS, 20 mmol/L Na4P2O7, 2 mmol/L Na3VO4, 1 mmol/L NaF, 1 mmol/L PMSF) supplemented with 1X protease inhibitor and phosphatase inhibitor (Roche) when necessary. Equal amount of protein samples were loaded and fractionated by SDS-PAGE, then transferred to 0.45 μm pore-size nitrocellulose membranes (Millipore). Membranes were blocked in 5% non-fat milk-TBS (w/v), then incubated with indicated primary antibodies. The following antibodies were used: TEAD1 (BD, #610922), Myc tag (Cell signaling, #2276), VGLL4 (Novus Biologicals, #NBP1–81543), MENIN (Abcam, # ab92443) and GAPDH. The blots were imaged using Licor Odyssey Clx and quantified by Image Studio ver 5.2 software.
Li F., Liu R., Negi V., Yang P., Lee J., Jagannathan R., Moulik M, & Yechoor V.K. (2023). VGLL4 and MENIN function as TEAD1 corepressors to block pancreatic β cell proliferation. Cell reports, 42(1), 111904.
+ Open protocol
+ Expand
6

Comprehensive Western Blotting Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blotting was performed as described.5 (link) Briefly, cell protein samples were prepared in ice-cold lysis buffer (100 mmol/L TrisHCl pH7.4, 10 mmol/L NaCl, 1 mmol/L EDTA, 1 mmol/L EGTA, 10% glycerol, 0.5% deoxycholate, 1% Triton X-100, 0.1% SDS, 20 mmol/L Na4P2O7, 2 mmol/L Na3VO4, 1 mmol/L NaF, 1 mmol/L PMSF) supplemented with 1X protease inhibitor and phosphatase inhibitor (Roche) when necessary. Equal amount of protein samples were loaded and fractionated by SDS-PAGE, then transferred to 0.45 μm pore-size nitrocellulose membranes (Millipore). Membranes were blocked in 5% non-fat milk-TBS (w/v), then incubated with indicated primary antibodies. The following antibodies were used: TEAD1 (BD, #610922), Myc tag (Cell signaling, #2276), VGLL4 (Novus Biologicals, #NBP1–81543), MENIN (Abcam, # ab92443) and GAPDH. The blots were imaged using Licor Odyssey Clx and quantified by Image Studio ver 5.2 software.
Li F., Liu R., Negi V., Yang P., Lee J., Jagannathan R., Moulik M, & Yechoor V.K. (2023). VGLL4 and MENIN function as TEAD1 corepressors to block pancreatic β cell proliferation. Cell reports, 42(1), 111904.
+ Open protocol
+ Expand
7

ChIP-seq analysis of transcription factors

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP was carried out as described previously 25 (link), 57 (link) with the following antibodies: goat IgG (Santa Cruz Biotechnology, sc-2028), Sox10 (R&D, AF2864), and Tead1 (BD Biosciences, 610923). Primers used included the following:
Tekt3 +7.8kb (Forward: aataccagcagatccggaagac, Reverse: ttgactcgttctcccaggtttt),
Itga6 −22.8kb (Forward: tgcttctgataagccccaac, Reverse: aagtcccagacacgtccttg),
Itga6 −20.6kb (Forward: tggaggcagaaggagaaaaa, Reverse: aggggcctgttaggaacact),
Itga6 −16.2kb (Forward: gacttgagctgtctgcatgg, Reverse: tggactgactaggcttccaca),
Itga6 −8.5kb (Forward: aaaagccaaacaaacccaga, Reverse: ggctagggcaagctaaggat),
Itga6 −7.8kb (Forward: tgcttttggtcatgtggttg, Reverse: accactggctagctcagcat),
Itga6 −165bp (Forward: tcgataaaacgccggagagt, Reverse: gtagctagcagccgctcaat),
Dag1 +3kb (Forward: atgaacccctcttcctgacc, Reverse: ccttgctgagactgtgctca),
Dag1 −36kb (Forward: ggatggaagactgaaaggcc, Reverse: ccctttccctctggtgtgag).
Poitelon Y., Lopez-Anido C., Catignas K., Berti C., Palmisano M., Williamson C., Ameroso D., Abiko K., Hwang Y., Gregorieff A., Wrana J., Asmani M., Zhao R., Sim F., Wrabetz L., Svaren J, & Feltri M. (2016). YAP and TAZ control peripheral myelination and the expression of laminin receptors in Schwann cells. Nature neuroscience, 19(7), 879-887.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!