Real-time PCR was run on the Applied Biosystems® 7500 Real-Time PCR with the same mastermix recipe and cycling conditions as the bisulfite PCR conditions detailed above, with the addition of SYTO™ 9 Green Fluorescent Nucleic Acid Stain (2 µM final) and ROX reference dye for real-time PCR (0.5 µM final), and replacement of 5X Green Flexi Buffer with 5X Colorless Flexi Buffer. Non-extensible dimers were determined by their appearance as bands in three separate samples on ethidium bromide stained gel electrophoresis. These samples included: a bisulfite–converted DNA template, no template control, and Taq-free control.
7500 real time pcr
Manufactured by Thermo Fisher Scientific
Sourced in United States, Japan, China, Germany
The 7500 Real-Time PCR is a laboratory instrument designed for real-time polymerase chain reaction (PCR) analysis. It provides precise and sensitive quantification of DNA or RNA targets in a variety of sample types. The system features a 96-well plate format, temperature control, and optical detection capabilities to enable accurate and reliable real-time PCR data collection and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (20 mentions)
Trizol, by Thermo Fisher Scientific (8 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (7 mentions)
Nanodrop one, by Thermo Fisher Scientific (5 mentions)
Veriti 96 well thermal cycler, by Thermo Fisher Scientific (4 mentions)
All in one rt mastermix, by Applied Biological Materials (4 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (4 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)
Nanodrop, by Thermo Fisher Scientific (3 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (3 mentions)
Taqman probe, by Thermo Fisher Scientific (3 mentions)
Evagreen 2x qpcr mastermix low rox, by Applied Biological Materials (2 mentions)
Eva green 2 qpcr master mix low rox, by Applied Biological Materials (2 mentions)
Sybr premix ex taq, by Takara Bio (2 mentions)
Perfecta sybr green fastmix low rox, by Quanta Biosciences (2 mentions)
Taqman real time pcr master mix, by Thermo Fisher Scientific (2 mentions)
Rneasy lipid tissue mini kit, by Qiagen (2 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Taqman assay, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
79 protocols using 7500 real time pcr
1
Real-time PCR for Detecting Non-extensible Dimers
2
Quantification of Lamin A Splicing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA and cDNA was purified and synthesized as for mRNA sequencing. Real-time qPCR was performed using Maxima SYBR Green qPCR Master Mix (Thermo Fischer scientific) on an Applied Biosystems 7500 Real-time PCR. Quantification of the WT or progerin/Δ150 splicing forms of lamin A was achieved with the fw and rv primer pairs indicated in Figure 3A using ribosomal protein lateral stalk subunit P0 (RPLP0) as reference gene. Differences in expression of alternative splicing products were analyzed with two-tailed unpaired t-test (P < 0.05) using GraphPad Prism 6.0 software.
These same cDNAs were used to detect splicing isoforms transcribed only from the transfected plasmids by RT-PCR. Specific detection of the WT or alternatively spliced forms of LMNA and PLP1, as well as GFP was achieved with the fw and rv primer pairs indicated in Figures3A and 5A . RT-PCR amplification was performed with the Dream Taq PCR master mix (Thermo Fisher scientific) as follows: 2 min at 95°C, 35 cycles of 30 s at 95°C, 30 s at 54°C and 45 s at 72°C, followed by a final extension of 5 min at 72°C. The PCR products obtained were resolved on a 2% agarose gel. Densitometry was performed using ImageJ. Differences in expression of alternative splicing products were analyzed with two-way anova (P < 0.05) using GraphPad Prism 6.0 software. All primer sequences are shown in Supplementary Table S1 .
These same cDNAs were used to detect splicing isoforms transcribed only from the transfected plasmids by RT-PCR. Specific detection of the WT or alternatively spliced forms of LMNA and PLP1, as well as GFP was achieved with the fw and rv primer pairs indicated in Figures
3
Comparative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression analysis was performed using 7500 Real Time PCR (Applied Biosystems) and power SYBR-GREEN PCR master MIX (Applied Biosystems). For this test primer pairs were synthesized based on GenBank sequences of mRNA. The comparative Ct method was used to measure changes in gene expression levels (13 (link)). Actin was used as an endogenous control.
4
Quantification of miR-124-3p and ARRDC1 in HCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from HCC tissues and cell lines, and cDNA was synthesized with TaqMan Reverse Transcription Kit. qRT-PCR was proceeded via PrimeScript RT Master Mix (TaKaRa). U6 and GAPDH served as loading control. The sequences of the primers used in PCR were in the following: miR-124-3p, F: 5’-GCTTAAGGCACGCGG-3’ and R: 5’-GTGCAGGGTCCGAGG-3’; U6, F: 5’-CTCGCTTCGGCAGCACATATACT-3’ and R: 5’-ACGCTTCACGAATTTGCGTGT-3’; ARRDC1, F: 5’-TAGTGGAGGAGGGTTACTTCAAC-3’ and R: 5’-TCTGGGATGCTGTTCAGGTTC-3’; GAPDH, F: 5’-CCACTCCTCCACCTTTGAC-3’ and R: 5’-ACCCTGTTGCTGTAGCCA-3’. Applied Biosystems 7500 real-time PCR (Applied Biosystems, Foster City, CA, USA) was used for qRT-PCR. All the primers were bought from IDT company. Mature miR-124-3p was used for qRT-PCR. Relative expression levels of mRNA and miRNA were calculated with the 2− ΔΔCt method [24 (link)].
5
VEGF Expression in MET5A Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from MET5A cells according to manufacturer's instructions (Invitrogen). The concentration of RNA obtained was measured by nanodrop. 1 μg of RNA obtained was reverse transcribed by RT‐PCR. Gene expression of VEGF was determined by 7500 Real Time PCR (Applied Biosystems). Samples were run in duplicate and normalized to 18s housekeeping gene. A standard curve generated from pooled mRNA samples was used for comparative quantification. Results are reported relative to 18s RNA.
6
Quantitative RT-PCR Analysis of Immune Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from spleens or aortas by the TRIzol Reagent (Ambion). 100 ng of spleen RNA and 40 ng aorta RNA were quantified with NanoDrop One (Thermo Scientific) and reverse transcribed using 5X All-In-One RT MasterMix (abm) preformed in Veriti 96-Well Thermal Cycler (Applied Biosystems). Quantitative real-time PCR was performed in 7500 Real-Time PCR (Applied Biosystems) using specific primers (synthesized by Sangon Biotech) and EvaGreen 2X qPCR MasterMix-Low ROX (abm). Reverse transcription and amplification conditions followed the reagent instructions. Data were analyzed via the 2-ΔΔCt method normalized to Gapdh. Sequences of primers were used as follows from 5′ to 3′ extremity:
Gapdh: AGGTCGGTGTGAACGGATTTG (F); TGTAGACCATGTAGTTGAGGTCA (R)
Stat3: CAATACCATTGACCTGCCGAT (F); GAGCGACTCAAACTGCCCT (R)
Stat5a: CGCCAGATGCAAGTGTTGTAT (F); TCCTGGGGATTATCCAAGTCAAT (R)
Jak2: TTGTGGTATTACGCCTGTGTATC (F); ATGCCTGGTTGACTCGTCTAT (R)
Socs3: ATGGTCACCCACAGCAAGTTT (F); TCCAGTAGAATCCGCTCTCCT (R)
Foxp3: CACCTATGCCACCCTTATCCG (F); CATGCGAGTAAACCAATGGTAGA (R)
Tgfb1: TGACGTCACTGGAGTTGTACGG (F); GGTTCATGTCATGGATGGTGC (R)
Cd80: ACCCCCAACATAACTGAGTCT (F); TTCCAACCAAGAGAAGCGAGG (R)
Cd86: AGTGATCGCCAACTTCAGTGAACC (F); GGTGACCTTGCTTAGACGTGCAG (R).
7
Quantification of DNA Methyltransferase Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol Reagent (Invitrogen) was used to extract total RNA from spleens or aortas. 100 ng/10 μL of spleen or aorta RNA were quantified with NanoDrop One (Thermo Scientific) and 5× All-In-One RT MasterMix (abm) was used for reverse transcription in Veriti 96-Well Thermal Cycler (Applied Biosystems). 7500 Real-Time PCR (Applied Biosystems) was used for qRT-PCR using specific primers (synthesized by Sangon Biotech) and Eva Green 2× qPCR Master Mix-Low ROX (abm). Reverse transcription and amplification conditions followed the reagent instructions. Data were analyzed via the 2-ΔΔCt method normalized to β-Actin. Sequences of primers were used as follows from 5′ to 3′ extremity:
β-Actin: GGCTGTATTCCCCTCCATCG (F); CCAGTTGGTAACAATGCCATGT (R);
Dnmt1: ATCCTGTGAAAGAGAACCCTGT (F);
CCGATGCGATAGGGCTCTG (R);
Dnmt3b: AGCGGGTATGAGGAGTGCAT (F);
GGGAGCATCCTTCGTGTCTG (R)
8
Quantification of M. hyopneumoniae in Lung Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lung tissues were collected at necropsy (56 dpi) and stored at −80°C until they were processed for PCR testing. As described elsewhere (18 (link)), lung (3 by 3 cm) containing both normal and affected tissue was minced using sterile scissors and then placed in a 50-ml conical tube with 30 ml of Earle’s balanced salt solution (Sigma-Aldrich, St. Louis, MO, USA) at a concentration of 10% (wt/vol). The sample was homogenized (2 min at 1,000 rpm; Geno/Grinder; Spex SamplePrep, Metuchen, NJ, USA) and then centrifuged (10 min at 4,200 × g).
M. hyopneumoniae DNA detection for both tracheal and lung homogenates was based on commercial kits (MagMax-96 Pathogen RNA/DNA kit, PCR VetMax-Plus qPCR master mix, VetMax Mycoplasma hyopneumoniae reagents; Applied Biosystems) performed as directed by the manufacturer. DNA was extracted on the Kingfisher Flex system and amplified on Applied Biosystems 7500 real-time PCR. Each plate included a known M. hyopneumoniae -positive sample (VetMax-Plus qPCR master mix kit includes Xeno DNA Control, Applied Biosystems) and a negative control sample (RNA-free water). A test result was considered valid when the internal positive CT value was ≤36. A sample was considered M. hyopneumoniae positive when CT values were ≤37.
9
Genetic Markers in Immune-Related Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SNPs in IL17A, IL10, and CD209 (DC-SIGN) gene were genotyped by allelic discriminations. In brief, genomic DNA was extracted using PureLink® Genomic DNA Mini Kit (Invitrogen™, USA). The concentration and purity of DNA were quantified using NanoDrop™ (Thermo Scientific™, USA). We genotyped DNA samples using IL17A rs2275913, IL10 rs1800871 and rs1800872, and CD209 rs2287886 and rs4804803 TaqMan® probe by qPCR using 7500 Real-Time PCR (Applied Biosystems, USA) following the instructions of the manufacturer. The results were assessed using TaqMan® Genotyper software version 1.6.0 (Applied Biosystems, USA). Information about the analyzed SNPs are presented in Supplementary Table 1
10
Quantifying Gene Expression Changes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was isolated using the TRIzol Reagent (Invitrogen, USA) according to the manufacturer's instructions. After detection of RNA concentration, 0.5 μg of total RNA was reverse‐transcribed into cDNA using the RT reagent kit (Taraka, Japan), and the cDNA was used for subsequent RT‐PCR using the SYBR‐Green PCR Mix (Takara) by a 7500 Real‐Time PCR (Applied Biosystems, MA, USA). The relative mRNA expression level was calculated using the 2‐ΔΔCt method. The sequences of primers for RT‐PCR were as following: E‐cadherin, Forward: 5′‐ATTTTTCCCTCGACACCCGAT‐3′, Reverse: 5′‐TCCCAGGCGTAGACCAAGA‐3′; Vimentin, Forward: 5′‐AGTCCACTGAGTACCGGAGAC‐3′, Reverse: 5′‐CATTTCACGCATCTGGCGTTC‐3′; G‐CSF, Forward: 5′‐ATAGCGGCCTTTTCCTCTACC‐3′, Reverse: 5′‐GCCATTCCCAGTTCTTCCAT‐3′; GAPDH, Forward: 5′‐CACTGGGCTACACTGAGCAC‐3′, Reverse: 5′‐AGTGGTCGTTGAGGGCAAT‐3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!