RNA extraction kits (Solarbio, China) were adopted to extract total RNA from cells and spinal cord lesion tissues. To be specific, miRNA extraction kits (Solarbio, China) were used for miR-494 in exosomes or cells, target mRNA or miR-494 acted as templates, and reverse transcription kits (Solarbio, China) were employed for reverse transcription into cDNA. Relative quantification of RNA expression levels was performed on an ABI 7500 Real-Time PCR system (Applied Biosystems, Carlsbad, CA). Furthermore, the 2-∆∆Ct method was employed for relative quantification, and U6 was the internal reference gene (refer to Supplement 3 for specific methods). Table 2 lists all the primers applied in the experiment.
Rna extraction kit
Manufactured by Solarbio
Sourced in China, United States
The RNA extraction kit is a laboratory tool designed for the efficient extraction and purification of RNA from various sample types. It utilizes a non-enzymatic, chemical-based approach to isolate high-quality RNA for downstream applications, such as gene expression analysis, reverse transcription, and other molecular biology techniques.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Formic acid, by Thermo Fisher Scientific (3 mentions)
Primescript rt master mix, by Takara Bio (2 mentions)
Cdna reverse transcription kit, by Vazyme (2 mentions)
Perfectstar green qpcr supermix dye 1 dye 2, by Transonic Systems (2 mentions)
Hifiscript gdna removal cdna synthesis kit, by CWBIO (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Acetonitrile, by Thermo Fisher Scientific (2 mentions)
Pbs buffer, by Thermo Fisher Scientific (2 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Solarbio (1 mentions)
Dynabeads m 280 streptavidin, by Thermo Fisher Scientific (1 mentions)
Warmstart lamp kit dna and rna, by New England Biolabs (1 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Takara one step rna pcr kit, by Takara Bio (1 mentions)
Sybr green system, by Takara Bio (1 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Glycerin, by Maclin Biochemical Technology (1 mentions)
Sodium carboxymethyl cellulose, by Maclin Biochemical Technology (1 mentions)
Dab chromogenic kit, by Wuhan Servicebio Technology (1 mentions)
25 protocols using rna extraction kit
1
Exosomal miR-494 Expression Analysis
2
qPCR Analysis of miR-92a Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR (qPCR) kits were purchased from Thermo Fisher Scientific (USA). TRIzol reagents and RNA extraction kits were purchased from Beijing Solarbio Science and Technology Co., Ltd. (Beijing, China). miR-92a and U6 primers were synthesized by Shanghai Shenggong Biological Engineering Co., Ltd. (Shanghai, China).
3
Isolation and Analysis of miR-1207-5p Targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HBMECs were transfected with biotinylated wild-type (Wt) miR-1207-5p, mutant miR-1207-5p (Genomeditech, Shanghai, China). First, cell lysates were harvested 48 h after transfection and incubated with Dynabeads M-280 Streptavidin (Invitrogen, CA, USA) for 3 h at 4 °C according to the manufacturer’s protocol. Then, the beads were washed three times with ice-cold lysis buffer and once with high-salt buffer according to a previous method [18 (link)]. The bound RNAs were purified using an RNA extraction kit (Solarbio, Beijing, China) for the qRT-PCR analysis.
4
SARS-CoV-2 Detection by PCR and LAMP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers sequences were designed to be against the E, N and ORF3 gene of SARS-CoV-2 (NC_045512.2) using Primer Explorer V5 in Table S2 . PCR and LAMP Primers and plasmids were synthesized by Sangon Biotech (Shanghai, China). EvaGreen 20× (25 µM) in water was purchased from Biotium, Inc. (Fremont, CA, USA). WarmStart® LAMP Kit (DNA and RNA) was from New England Biolabs (Beijing, China). COVID-19 RNA reference material (high concentration, GBW(E)091089) was from the National Institute of Metrology of China. The RNA extraction kit was from Beijing Solarbio Science and Technology Co., Ltd. (Beijing, China).
5
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were lysed by TRIzol reagent (Thermo Fisher Scientific). Total RNA was extracted using RNA Extraction Kit (Solarbio) following the manufacturer’s protocol. After checking the purity and integrity of RNA, a total of 1 μg RNA was reverse transcribed using the TaKaRa One Step RNA PCR Kit (RR024B, TaKaRa, Japan) according to the manufacturer’s instructions by 7500 Real-Time PCR Systems (Applied Biosystems, Foster City, CA). U6 and β-actin served as control. The mRNA levels of TUG1, DUSP6, TNFα, IL-6, fibronectin (FN1) and collagen IV (COL4A2) were determined by quantitative real-time PCR. The data obtained after three independent experiments were calculated by the formula relative quantification (RQ)=2- ΔΔ CT method. All the primers were listed in Table 1 .
6
Quantifying miRNA-372-3p Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by an RNA extraction kit (Solarbio, China) and reverse transcribed into cDNA by PrimeScript RT Master Mix (Takara Bio). qRT-PCR was performed with a SYBR Green system (Takara) according to the following parameters: 95°C for 10 min, followed by 40 cycles of 95°C for 10 s, and 60°C for 50 s. For miRNA expression, U6 were used as internal reference controls for miRNA expression, respectively, and relative expression was calculated using the 2−ΔΔCt method and was used to calculate the relative expression levels of miR-372-3p. Primers: miR-372-3p, forward 5′-TTT CAC GAC GCT GTA AAC TCG CA-3′, reverse 5′ -GTG CAG GGT CCG AGG T-3′; U6, forward 5′-GCT TCG GCA GCA CAT ATA CTA A-3′, reverse 5′-AAC GCT TCA CGA ATT TGC GT-3′.
7
Quantitative Analysis of LYRM4-AS1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted according to the manufacturer’s instructions by the RNA extraction kit (Solarbio, Beijing, China). Total RNA was reverse transcribed into cDNA using a cDNA Reverse Transcription Kit (Vazyme, Nanjing, China). RT-qPCR reaction conditions: predenaturation at 95 °C for 5 min; 40 cycles at 95 °C for 10 s and 60 °C for 30 s; melt curve at 95 °C for 15 s, 60 °C for 60 s and 95 °C for 15 s. The β-actin was used as an internal reference. The relative mRNA expression of LYRM4-AS1 was calculated using the 2−ΔΔCt method (Livak & Schmittgen, 2001 (link)). The sequences of primers are listed in Table 1 .
8
Extraction and Quantification of Rat Skin RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Skin tissue (obtained in D11 and D23, mentioned in Section 4.3) of the rat was removed at −80°C and weighed at 50–100 mg by the analytical balance in an RNA enzymes free tube (2 mL) and treated with 1 mL TRIzol Reagent. Total RNA was extracted with RNA Extraction Kit (Solarbio, Beijing) according to the manufacturer's protocol, and quantified by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA).
Following the manufacturer's process, one microgram of RNA was reverse transcribed by the HiFiScript gDNA Removal cDNA Synthesis Kit (CWBIO). Several transcripts were measured using PerfectStar Green qPCR SuperMix (+Dye I/+Dye II) (TRANS, China) through ViiA™ 7 Real‐Time PCR System (Applied Biosystems). Specific primers are listed in Table1 .
Following the manufacturer's process, one microgram of RNA was reverse transcribed by the HiFiScript gDNA Removal cDNA Synthesis Kit (CWBIO). Several transcripts were measured using PerfectStar Green qPCR SuperMix (+Dye I/+Dye II) (TRANS, China) through ViiA™ 7 Real‐Time PCR System (Applied Biosystems). Specific primers are listed in Table
9
Wound Healing Gel Formulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The chemical materials used in this study include SPRC (also named ZYZ‐802, Shanghai), carbomer 940 (Macklin, China), sodium carboxymethyl cellulose (Macklin), glycerin (Macklin), sodium hydroxide (Macklin), Tween‐20 (Sigma, USA), Tween‐80 (Macklin), TRIzol reagent (Carlsbad, CA, USA), and phosphate‐buffered saline (PBS) tablets (Gaithersburg, MD, USA). Recombinant bovine bFGF was purchased from Essex Bio‐Technology (Zhuhai, China). Hydrogen peroxide solution was obtained from ANNJET (Shandong, China). Alcohol, n‐butanol, and xylene were purchased from SINOPHARM (Shanghai, China). Masson Tricolor Staining Kit, HE Staining Kit, BioDewax and clear solution, tris‐ethylene diamine tetraacetic acid antigen retrieval solution (Tris‐EDTA), pH = 9.0), bovine serum albumin (BSA), horseradish peroxidase (HRP) conjugated goat anti‐rabbit IgG (H+L), and DAB chromogenic kit were purchased from Servicebio (Wuhan, China). Total RNA was extracted with RNA Extraction Kit was purchased from Solarbio (Beijing, China). The HiFiScript gDNA Removal cDNA Synthesis Kit was obtained from CWBIO (Jiangsu, China). The PerfectStar Green qPCR SuperMix (+Dye I/+Dye II) was purchased from TRANS (Beijing, China).
10
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from liver tissue or AML cells using RNA Extraction Kit (Solarbio, Beijing, China). For cDNA synthesis, the RNA was reverse transcribed with cDNA Synthesis Kit (Accurate, Hunan, China), and real-time polymerase chain reaction was performed by using SYBR Premix ExTaq (Accurate, Hunan, China). Results were normalized to GAPDH mRNA expression. Polymerase chain reaction primers used are listed below:
GAPDH: CAAAGTTGTCATGGATGACC (F), CCATGGAGAAGGCTGGGG (R); ACC: CTTCCTCCTGATGAGCAACTCT (F), CGTGAGTTTTCCCAAAATAAGC (R); SREBP-1c: GAGG CCAAGCTTTGGACCTGG (F), CCTGCCTTCA GGCTTCTCAGG (R); IL-1β: TTCATCTTTGAAGAAGAGCCCAT (F), TCGGAGCCTGTAGTGCAGTT (R); IL-6: TGGAAATGAGAAAAGAGTTGTGC (F), CCAGTTTGGTAGCATCCATCA (R); IL-13: AACGGCAGCATGGTATGGAGTG (F), TGGGTCCTGTAGATGGCATTGC (R); IL-17A: CCTTCACTTTCAGGGTCGAG (F), CAGTTTGGGACCCCTTTACA (R); TNF-α: ATCTACCTGGGAGGCGTCTT (F), GAGTGGCACAAGGAACTGGT (R).
GAPDH: CAAAGTTGTCATGGATGACC (F), CCATGGAGAAGGCTGGGG (R); ACC: CTTCCTCCTGATGAGCAACTCT (F), CGTGAGTTTTCCCAAAATAAGC (R); SREBP-1c: GAGG CCAAGCTTTGGACCTGG (F), CCTGCCTTCA GGCTTCTCAGG (R); IL-1β: TTCATCTTTGAAGAAGAGCCCAT (F), TCGGAGCCTGTAGTGCAGTT (R); IL-6: TGGAAATGAGAAAAGAGTTGTGC (F), CCAGTTTGGTAGCATCCATCA (R); IL-13: AACGGCAGCATGGTATGGAGTG (F), TGGGTCCTGTAGATGGCATTGC (R); IL-17A: CCTTCACTTTCAGGGTCGAG (F), CAGTTTGGGACCCCTTTACA (R); TNF-α: ATCTACCTGGGAGGCGTCTT (F), GAGTGGCACAAGGAACTGGT (R).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!