Rna extraction kit

To validate the transcriptome data of spleen and inguinal lymph nodes after ASFV infection, real-time quantitative PCR (RT-qPCR) was performed, and primers are listed in Table S1 in the supplemental material. In brief, the total mRNA of homogenized tissues was extracted using an RNA extraction kit (Magen, Guangzhou, China) and followed by reverse transcription by means of HiScript reverse transcriptase (Vazyme, Nanjing, China). qPCRs were conducted on a QuantStudio 6 Flex system (Life Technologies, Carlsbad, CA, USA) as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, 60°C for 15 s, and 72°C for 15 s.
To calculate the copy number of ASFV genomic DNA from swabs, cell supernatants, and tissue homogenates, qPCR was performed as described previously (32 (link)). In brief, ASFV genomic DNA samples were extracted using EasyPure viral DNA/RNA kit (TransGen Biotech, Beijing, China) and qPCR was performed on a QuantStudio 6 system (Applied Biosystems, Waltham, MA, USA).

Total RNA from 1×10⁵ cells was first isolated using an RNA extraction kit (R4111-03, Magen) according to the manufacturer’s instructions. cDNA was obtained using a reverse transcription kit (TOYOBO, FSQ-101) and subjected to qRT-PCR. The sequences of primers used were as follows: PRKN-F: 5’-GTGCAGAGACCGTGGAGAAA-3’; PRKN-R: 5’-GCTGCACTGTACCCTGAGTT-3’, CAT-F: 5’-AAAAGATATCATGGCTGACAGCCGGGAT-3’; CAT-R: 5’-AAAAGCGGCCGCTCACAGATTTGCCTTCTC-3’, GAPDH-F: 5’-GACTCATGACCACAGTCCATGC-3’; GAPDH-R: 5’-AGAGGCAGGGATGATGTTCTG-3’. The CT values of GAPDH were used for normalization.

Total RNA of latex in control group and MeJA treated group of Euphorbia kansui were isolated with a RNA extraction kit (Magen, China). The concentration and quality of each total RNA sample was measured by NanoDrop ND-2000 (Thermo, Waltham, USA) and 1% agarose gel. Approximately 5 μg of total RNA from each group was used for the first-strand cDNA synthesis using iscriptTM cDNA Synthesis Kit Real Time (Zoman, China). The cDNAs were kept at −20 °C. Real-time quantitative PCR analyses were performed by a two-step PCR procedure with 2 × SYBR Green qPCR Mix and the CFX96™ Real-Time PCR System (Bio-Rad). The real-time PCR mixture of 25 µL included 1 µL of cDNA solution, 12.5 µL of 2 × SBRY qPCR Mix, 0.5 µL of forward primer, and 0.5 µL of reverse primer, 10.5 µL of dd H2O water to final volume. PCR conditions were as follows: 94 °C for 2 min, followed by 40 cycles at 94 °C for 10 s and 60 °C for 30 s. Primes used for qRT-PCR was listed in the Table S5. β-Actin was also amplified as an internal reference for the same sample and shown in Table S5 (Supplementary Materials). The 2−ΔΔCt comparative CT method was used for calculating the genes expression.

The RNA in PVA, MoS₂/PVA, GO/PVA, and MoS₂/GO/PVA hydrogels treated groups was extracted by RNA extraction kit (R4114-02, Magen, China), and RNA was reversely transcribed into cDNA by reverse transcription kit (11939823001, Roche, Switzerland). RT-PCR was performed using Maxima TM SYBR Green/Rox qPCR Master Mix (4710436001, Roche, Switzerland). Each individual PCR assay was repeated at least three times, and the expression of GAPDH was used to calculate the expression level of each detected gene. 2^–ΔΔ quantitative Ct method was used to calculate relative gene expression. The primers used in this study are listed in Table 1.Table 1

Primers sequence used for real-time PCR

Target	Forward	Reverse
GAPDH	AGGTCGGTGTGAACGGATTTG	GGGGTCGTTGATGGCAACA
GFAP	CGGAGACGCATCACCTCTG	TGGAGGAGTCATTCGAGACAA
HB9	GAACACCAGTTCAAGCTCAACA	GCTGCGTTTCCATTTCATTCG
Islet-1	TTTCCCTGTGTGTTGGTTGC	TGATTACACTCCGCACATTTCA
ChAT	GGCCATTGTGAAGCGGTTTG	GCCAGGCGGTTGTTTAGATACA
Tuj1	TAGACCCCAGCGGCAACTAT	GTTCCAGGTTCCAAGTCCACC
IL-10	TTGTCGCGTTTGCTCCCATT	GAAGGGCTTGGCAGTTCTG
IL-6	TGGGGCTCTTCAAAAGCTCC	AGGAACTATCACCGGATCTTCAA
TNF-α	CAGGCGGTGCCTATGTCTC	CGATCACCCCGAAGTTCAGTAG

Total RNA was extracted from samples using RNA Extraction Kit (Magen). RevertAid First Strand cDNA Synthesis Kit (Thermo) was used to perform reverse transcription according to the instructions. RT‐PCR analysis was performed using 7500 Fast Real‐Time PCR System (Applied Biosystems) with SYBR green mix (Vazyme) . Primers were listed as follows: USP20 (forward: 5′‐TGGGCTAGTCTGTAAGTCGC‐3′; reverse: 5′‐GGGACCTGCTCTTTGGATGTT‐3′); SLC7A11 (forward: 5′‐TGCTGGGCTGATT‐TATCTTCG‐3′; reverse: 5′‐GAAAGGGCAACCATGAAGAGG‐3′); c‐MYC (forward: 5′‐CCTTTGGGCGTTGGAAACC‐3′; reverse: 5′‐CGTCGCAGATGAAATAGGG‐3′); SOX2 (forward: 5′‐GCCCTGCAGTACAACTCCAT‐3′; reverse: 5′‐GACTTGACCACCGAACCCAT‐3′); Nanog (forward: 5′‐GTCCCAAAGGCAAACAACCC‐3′; reverse: 5′‐GCTGGGTGGAAGAGAACACA‐3′); Oct4 (forward: 5′‐TTTTGGTACCCCAGGCTATG‐3′; reverse: 5′‐GCAGGCACCTCAGTTTGAAT‐3′); GAPDH (forward: 5′‐ACGGGAAGCTTGTCATCAAT‐3′, reverse: 5′‐TGGACTCCACGACGTACTCA‐3′).

To detect the expression of the structural proteins and PS576 of SARS-CoV-2, transfected cells were collected and the RNA was purified with an RNA extraction kit (Magen, Guangzhou, China). Reverse transcription was then conducted to acquire the cDNA template using a reverse transcription kit (Vazyme, Nanjing, China) according to the manufacturer's instructions. Specific primers (Table S1) were then used to amplify the structural protein genes and PS576 sequence. GAPDH was used as the internal control. Similar procedure was conducted to detect the EGFP and PS576 in VLP (EGFP-PS576) or VLPdN (EGFP-PS576) virions.