The largest database of trusted experimental protocols

11 protocols using w1503

1

Prepare PM2.5-1 Particle Suspension

Check if the same lab product or an alternative is used in the 5 most similar protocols
We used PM samples obtained from a sampling campaign conducted in China during 2014. PM samples were collected at Nanjing University (NJU) Xianlin campus. Details of the collection method, the origin of the sample, PM composition, and method of size-segregation have been described earlier by Jalava et al. (2015) (link) and Rönkkö et al. (2018) (link). In brief, we used PM2.5-1 samples collected with high volume cascade impactor during night time. The sampler collects four different size ranges, from which the fine particle size was chosen for this study. PM2.5-1 samples were stored at −20 °C until the day of the exposure. On the day of exposure PM2.5-1 samples were suspended in 10% dimethyl sulfoxide (DMSO) (Sigma Aldrich, USA) in endotoxin tested water (Sigma, W1503) and sonicated for 30 min before utilization for exposure. After administrating the samples to cell culture medium, the final DMSO concentration was <0.3%.
+ Open protocol
+ Expand
2

Sequence-Specific Inhibition of NR3C1 Translation

Check if the same lab product or an alternative is used in the 5 most similar protocols
A NR3C1 specific MAO was designed to bind the 5′UTR upstream of the translation initiation site in the rhesus macaque NR3C1 gene (XM_015141112.1: TGGAGTCCATCAGTGAATATCAACT), thereby inhibiting its translation. A MAO recognizing a splice site mutant of the human hemoglobin beta-chain (HBB) gene (AY605051: CCTCTTACCTCAGTTACAATTTATA) was used as a standard (STD) control. Both the NR3C1 and STD MAOs were synthesized with a 3′-carboxyfluorescein tag to aid in visualization during embryo microinjection. Oocytes were collected at 6 h or 36 h following hCG injection to rhesus macaque females undergoing a COS protocol. The MAOs were reconstituted in embryo grade water (Sigma- Aldrich, W1503) and microinjected using a CellTram vario, electronic microinjector and Transferman NK 2 Micromanipulators (Eppendorf, Hauppauge, New York, USA). The MAO concentration (0.3 mM) was chosen based on previous reports that this concentration of STD MAO did not impact blastocyst formation rates in both mice41 (link) and rhesus macaques42 (link).
+ Open protocol
+ Expand
3

CRISPR Guide RNA Preparation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Custom crRNA (IDT, Alt-RTM crRNA) and generic tracrRNA (IDT, 1072532) were resuspended to 100 μM in sterile and nuclease-free T10E0.1 buffer (10 mM Tris-HCl, 0.1 mM EDTA, embryo-tested water (Sigma, W1503)) prepared as described [16 (link)]. 50 μM crRNA:tracrRNA complexes (pgRNA) were generated by subjecting equimolar ratios to 95°C for 5 min followed by reduction of 5°C/min. sgRNA was generated by T7 RNA polymerase mediated in vitro transcription (NEB, E2040S) from the pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene #48138) from Feng Zhang and column purified (Qiagen, 217004). Guide RNAs were stored at -80°C. crRNA sequences are listed in S1 Table.
+ Open protocol
+ Expand
4

Embryo Transfer Medium Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols
All powders listed in Supplementary Table S5 were weighted and diluted in water for embryo transfer (Sigma, W1503). The medium was filtered through a 0.22 µm filter and stored at 4°C for up to 3 months. At the morning of IVF experiments, 180 µL drop of pre-incubation medium was placed on the bottom of 35 mm Petri dishes (Falcon 351008) and covered with mineral oil.
+ Open protocol
+ Expand
5

Cryopreservation of Sperm using Raffinose-Skim Milk

Check if the same lab product or an alternative is used in the 5 most similar protocols
For the cryopreservation of sperm gCPA containing 18% raffinose pentahydrate and 3% skim milk supplemented with 100 mM L-glutamine was prepared as published [18 (link), 27 (link)]. Briefly, 0.146 g of L-glutamine (Sigma; G8540) was placed in 10 ml of prewarmed (60°C) water (Sigma; W1503) and vortexed for 3 min. Subsequently, 1.8 g of raffinose pentahydrate (Sigma; R7630) and 0.3 g of skim milk (Becton Dickinson; 232100) was added, the solution vortexed for 3 min and incubated for 90 min at 60°C. gCPA was vortexed every 30 min for 3 min. Next, the solution was centrifuged at 10,000 g for 60 min and the supernatant was filtered through a 0.22 μm filter (PALL; 4652). After osmolality check (500–520 mOsm/kg) aliquots were stored at room temperature for up to 3 months.
+ Open protocol
+ Expand
6

Microinjection of Fluorescent Reporters in Mouse Oocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Fully grown prophase-arrested GV oocytes were isolated from ovaries of females between 8 and 12 weeks old using sterile insulin needles in M2 medium (Sigma-Aldrich) supplemented with 200 µM IBMX (Sigma-Aldrich). mRNA micro-injection in the cytoplasm of oocytes was done as previously described30 (link). Injected mRNAs (5–10 pl) were diluted in RNase-free water at the following concentrations: H2B–mCherry: 150 ng µl−1, Mad2: 200 ng µl−1, TALE-mClover_MajSat: 100 ng µl−1, tubulin: 150 ng µl−1, NCAPH2–eGFP: 50 ng µl−1, TEV protease: 250 ng µl−1. After injection, oocytes were incubated in M16+IBMX in a 5% CO2, 37 °C incubator, to allow the full expression of the injected RNA. After washes in M16 to remove IBMX, oocytes were analysed by live cell confocal microscopy. Both M2 and M16 were prepared in water for embryo transfer (Sigma, W1503) according to the protocol and references indicated in ref. 42 .
+ Open protocol
+ Expand
7

HTF Medium Preparation with GSH

Check if the same lab product or an alternative is used in the 5 most similar protocols
All powders listed in Supplementary Table S4 were weighted as indicated and diluted in water for embryo transfer (Sigma, W1503). The medium was filtered through 0.22 µm filter and stored at 4°C for up to 3 months. At the morning of the IVF experiments, 30.7 mg of reduced glutathione (GSH) was added to 1 ml of HTF and mixed. 50 µL from this solution was added to the 5 ml of fresh HTF medium, filtered and used to prepare fertilization dishes. 90 µL drops of HTF medium with GSH were placed on the bottom of 35 mm Petri dishes (Falcon 351008), covered with mineral oil and incubated at 37°C, 5% CO2 for 20 min.
+ Open protocol
+ Expand
8

Embryo Fixation and Serial Block-Face SEM

Check if the same lab product or an alternative is used in the 5 most similar protocols
Embryos were fixed in 2.5% glutaraldehyde in embryo grade water (Sigma, W1503) for 1–2 h at room temperature. Fixed embryos were rinsed with 1x PBS and stored at 4 °C before processing. Processing was performed exactly as described previously76 (link). Serial blockface sectioning and scanning electron microscopy were performed using a VolumeScope serial block-face EM (Thermo Fisher, Waltham, MA) equipped with a low-vacuum backscatter detector (VS-DBS; Thermo Fisher).
+ Open protocol
+ Expand
9

Emission Particle Exposure on Macrophages

Check if the same lab product or an alternative is used in the 5 most similar protocols
Half an hour before the exposure, emission particles were suspended into DMSO (20 μL mg−1, Merck KGaA, Germany). After that, pathogen-free water (W1503, Sigma-Aldrich Corp., USA) was added to gain a PM concentration of 5 mg mL−1. This suspension was sonicated in an ultrasonic water bath (FinnSonic m03, FinnSonic Ltd., Finland) for 30 min below +35 °C to gain homogenous mixture. Mouse RAW264.7 macrophages were exposed for 24 h to four doses (15, 50, 150, and 300 μg mL−1) of emission particles from wood log combustion. Exposures of the cells to the particulate samples were made at least in three independent experiments. All in vitro experiments contained diesel PM (dose 150 μg ml−1) [63 (link)] and blank substrate (dose 150 μg ml−1) controls. Moreover water (dose 1.7 mM) and DMSO (dose 41.1 μM) served as vehicle controls. Blank sample virtual mass was calculated to be equivalent for PM containing filters average mass.
+ Open protocol
+ Expand
10

Optimized IVF Fertilization Medium

Check if the same lab product or an alternative is used in the 5 most similar protocols
For the IVF procedure a commercial RVF fertilization medium (Research Vitro Fert, Cook Medical; K-RVFE-50) was supplemented with 1 mM (frozen sperm) or 0.25 mM (freshly harvested sperm) reduced GSH (Sigma; G4251) and the calcium concentration was increased from default 2.04 mM to 5.14 mM (mRVF). Therefore, a 100x CaCl2 stock solution (310 mM) was prepared by dissolving 0.4558 g of CaCl2 (Sigma; C7902) in 10 ml of water (Sigma; W1503). The solution was filtered through a 0.22 μm filter and aliquots were stored at -20°C for a maximum of 6 months. On the day of IVF an aliquot of CaCl2 was thawed at room temperature. Subsequently, 150 μl of 100x CaCl2 was added to 15 ml of fertilization medium and mixed gently. Next, 1 ml of fertilization medium supplemented with CaCl2 was placed in a tube containing 30.7 mg of GSH and vortexed. 50 μl (frozen sperm) or 10 μl (freshly harvested sperm) of this solution was added to 5 ml (frozen sperm) or 4 ml (freshly harvested sperm) of fertilization medium supplemented with CaCl2, mixed gently and filtered using 0.22 μm syringe end filter.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!