Standard RNA templates containing the N gene of SARS-CoV-2 were prepared for optimizing and measuring the isolation efficiency of chitosan-modified filter paper for viral RNA extraction using a probe-based RT-qPCR assay based on the N2 target of the CDC assay (Holshue et al., 2020 (link)). RT-qPCR was performed using One Step PrimeScript™ III RT-qPCR Mix (TAKARA) with the following primers: the forward primer 5′-TTA CAA ACA TTG GCC GCA AA-3′ and the reverse primer 5′-GCG CGA CAT TCC GAA GAA-3′. The RT-qPCR assay was run using a TaqManTM probe with the following sequence: 5′-FAM-ACA ATT TGC CCC CAG CGC TTC AG-BHQ1-3′. All the PCR assays were carried out on the Bio-rad CFX96 System with an RT step of 52 °C for 5 min followed by 45 cycles with a denaturing step of 95 °C for 5 s and an annealing and elongation step of 60 °C for 30 s. We evaluated the performance of the chitosan-modified filter paper combined with the tetra-primer RPA for the detection of viral RNA using 2019-nCoV RNA reference material (National Institute of Metrology, China).
One step primescript 3 rt qpcr mix
Manufactured by Takara Bio
Sourced in Japan, China
One Step PrimeScript III RT-qPCR Mix is a reagent kit designed for reverse transcription and real-time quantitative PCR (RT-qPCR) in a single reaction. It contains the necessary components for both processes, facilitating efficient and streamlined gene expression analysis.
Automatically generated - may contain errors
Lab products found in correlation
Qiaamp viral rna mini kit, by Qiagen (5 mentions)
Quantstudio 3, by Thermo Fisher Scientific (3 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (3 mentions)
Steponeplus instrument, by Thermo Fisher Scientific (3 mentions)
Sars cov 2 direct detection rt qpcr kit, by Takara Bio (2 mentions)
Maxwell viral total nucleic acid purification kit, by Promega (2 mentions)
Maxwell rsc simplyrna tissue kit, by Promega (2 mentions)
Cell counting kit 8 (cck8), by Dojindo Laboratories (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Cfx96 system, by Bio-Rad (1 mentions)
Lightcycler 480, by Roche (1 mentions)
Purelink rna kit, by Thermo Fisher Scientific (1 mentions)
Lightcycler nano system, by Roche (1 mentions)
Trizol ls reagent, by Thermo Fisher Scientific (1 mentions)
Qpcrsoft, by Analytik Jena (1 mentions)
Qtower3g, by Analytik Jena (1 mentions)
Nucleospin rna virus kit, by Macherey-Nagel (1 mentions)
Maxwell rsc instrument, by Promega (1 mentions)
Lightcycler 480 2 system, by Roche (1 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (1 mentions)
32 protocols using one step primescript 3 rt qpcr mix
1
Chitosan-Modified Filter Paper for SARS-CoV-2 RNA Extraction
2
Multiplex qRT-PCR Assay Development
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Takara Onestep PrimeScript™ III RT-qPCR Mix (Takara, Dalian, China) was used to build the multiplex qRT-PCR assays. Each reaction mix consisted of 10 μl One Step PrimeScript™ III RT-qPCR Mix, 0.4 μl forward primer (10 μM), 0.4 μl reverse primer (10 μM), 0.4 μl probe (5 μM), 2 μl RNA template, supplemented with RNase free water to a final volume of 25 μl (the concentration of each set of primers & probe (0.05 μM to 0.5 μM for each primer, and 0.025 μM to 2.5 μM for each probe) was evaluated in advance to reach an optimal work concentration). Each reaction was run in triplicate with 96-well plates by using a Roche LightCycler 480 (Roche, IN, USA). The thermocycling conditions for each qRT-PCR assay were as follows: 52°C 15 min for reverse transcription, 95°C 10 sec for thermal inactivation of the reverse transcriptase, followed by 45 cycles of 95°C 30 sec and 60°C 1min for PCR amplification (a thermal gradient experiment (58°C-62°C) was performed in advance to reach an optimal work temperature for annealing and extension). Fluorescence acquisition was set at the annealing/extension step of each cycle.
3
Quantifying SARS-CoV-2 RNA via RT-qPCR Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To quantify SARS-CoV-2 RNA, two RT-qPCR assays, NIID_2019-nCoV_N (hereafter, NIID_N2) (Shirato et al. 2020 (link)), and a combination of CDC 2019-nCoV_N1 and CDC 2019-nCoV_N2 (CDC_N1N2) (Centers for Disease Control and Prevention 2020 ), were performed. Primers and probes, with sequences that are listed in Table S1 , were purchased from Takara Bio (Kusatsu, Japan). Reaction mixtures were prepared using the One Step PrimeScript III RT-qPCR Mix (Takara Bio) for the NIID_N2 assay, and the SARS-CoV-2 Direct Detection RT-qPCR Kit (Takara Bio) for the CDC_N1N2 assay. Thermal cycling was performed with an ABI 7500 Fast thermal cycler (Thermo Fisher Scientific, MA, USA), and the thermal cycling conditions for both RT-qPCR assays were as follows: initial incubation at 50 °C for 30 min and initial denaturation at 95 °C for 5 min, followed by 45 cycles of denaturation at 95 °C for 15 s, and the primer annealing and extension reaction at 60 °C for 60 s.
The previously isolated strain, JPN/TY/WK-521 (provided by Dr. Nagata, National Institute of Infectious Diseases) (Matsuyama et al. 2020 (link)), was used to compare the two RT-qPCR assays. RNA was extracted from the stocked isolate using the QIAamp Virus RNA kit (Qiagen) and analyzed via RT-qPCR assays using NIID_N2 and CDC_N1N2 sets.
The previously isolated strain, JPN/TY/WK-521 (provided by Dr. Nagata, National Institute of Infectious Diseases) (Matsuyama et al. 2020 (link)), was used to compare the two RT-qPCR assays. RNA was extracted from the stocked isolate using the QIAamp Virus RNA kit (Qiagen) and analyzed via RT-qPCR assays using NIID_N2 and CDC_N1N2 sets.
4
Quantitative RT-PCR for SARS-CoV-2 and Influenza
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from organs by Pure link RNA kit (Thermo Fisher Scientific). RT-qPCR was performed with viral gene specific primers26 (link),27 (link) using the One Step PrimeScript™ III RT-qPCR Mix (Takara Bio Inc., Shiga, Japan) according to the manufacturer’s instructions. The N gene of SARS-CoV-2 or the M gene of IAV was amplified using the following paired primers and probes; forward primer 5′-AAATTTTGGGGACCAGGAAC-3′, reverse primer 5′-TGGCAGCTGTGTAGGTCAAC-3′, probe 5′-(FAM)ATGTCGCGCATTGGCATGGA(BHQ)-3′ (SARS-CoV-2) or forward primer 5′-CCMAGGTCGAAACGTAYGTTCTCTCTATC-3′, reverse primer 5′-TGACAGRATYGGTCTTGTCTTTAGCCAYTCCA-3′, probe 5′-(FAM)ATYTCGGCTTTGAGGGGGCCTG(MGB)-3′ (IAV), respectively. The following template cDNA were used for standard; 5′-GCCAGTGAATTGTAATACGACTCACTATAGGGCGAAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCATCAA-3′ (SARS-CoV-2) and 5′-AGTCTTCTAACCGAGGTCGAAACGTACGTTCTCTCTATCATCCCGTCAGGCCCCCTCAAAGCCGAGATCGCACAGAGACTTGAAGATGTCTTTGCAGGGAAGAACACCGATCTTGAGGTTCTCATGGAATGGCTAAAGACAAGACCAATCCTGTCACCTCTGACTA-3′ (IAV).
5
SARS-CoV-2 Detection via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-qPCR was performed as described previously [10 (link)]. Nucleic acid extraction of SARS-CoV-2 was performed using the Maxwell® Viral Total Nucleic Acid Purification Kit (Promega Corporation, Madison, WI, USA), and RT-qPCR was performed using the One Step PrimeScript™ III RT-qPCR mix (Takara Bio Inc., Japan). The N gene was targeted with a forward primer (2.4 μM), 5′-AAA TTT TGG GGA CCA GGA AC-3′; reverse primer (3.2 μM), 5′-TGG CAG CTG TGT AGG TCA AC-3′; and probe (0.4 μM) 5′-FAM-ATG TCG CGC ATT GGC ATG GA-BHQ-3′. The method was performed according to the manufacturer's protocol.
6
SARS-CoV-2 Reference RT-PCR Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After used for the in-house PCR, the purified samples were frozen at −80 °C and transferred to Mizuho Medy for the reference real-time RT-PCR assay. The N1 and N2 primer/probe set (Nihon Gene Research Laboratories, Miyagi, Japan) were employed for the reference real-time RT-PCR assay, as suggested by the “Manual for the Detection of Pathogen 2019-nCoV Ver. 2.9.1” issued by the National Institute of Infectious Diseases of Japan (NIID) [10 (link)]. The reference real-time RT-PCR assays were performed on a LightCycler® Nano System (Roche Diagnostics, Rotkreuz, Switzerland) using One Step PrimeScript™ III RT-qPCR Mix (Takara Bio, Kusatsu, Japan) with the following cycling conditions: reverse transcription at 52 °C for 5 min and 95 °C for 10 s, and 45 cycles at 95 °C for 5 s and at 60 °C for the 30s. A PCR result was considered “positive” when the Ct value was ≤40 [10 (link)]. The absolute viral copy number was determined by serially diluted RNA control targeting the N2 gene of SARS-CoV-2 (Nihon Gene Research Laboratories). For the comparison between the Ct values of Smart Gene SARS-CoV-2 and the reference real-time RT-PCR assay, we used the Ct values of N2 gene.
7
Quantification of YEZV Viral RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the 10% tissue emulsions, mice serum or cell culture supernatant using TRIzol LS Reagent (Thermo Fisher Scientific, U.S.) and used to quantify YEZV viral RNA expression. Quantities of YEZV viral RNA were measured using RT-qPCR with One Step PrimeScript III RT-qPCR Mix (Takara Bio, Shiga, Japan) and the specific primers (5’-GGTGTAAAGCCCAACATCCT-3’ and 5’-CTCAACCTGCTTCCAACCTATC-3’) and probe (5’-/5Cy5/CCAAGGAAG/TAO/CACACAGATGGGTACA/3IAbRQSp/-3’) for the L gene. The RT-qPCR reaction protocol included 5 minutes at 52°C, 10 seconds at 95°C and then 40 cycles of 5 seconds at 95°C and 30 seconds at 60°C. The signals were measured at the elongation step. A cloned plasmid was used for the standard to estimate the copy number. RT-qPCR was performed using qTower3 G (Analytik Jena, Jena, Germany), and the obtained data were analyzed by qPCRsoft (Analytik Jena, Jena, Germany).
8
SARS-CoV-2 RNA Extraction and qPCR Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SARS-CoV-2 RNA was extracted from the collected viral samples from each plate using a NucleoSpin RNA Virus kit (MACHEREY-NAGEL GmbH & Co. KG., Düren, Germany) following the manufacturer's protocol. Conventional RT-qPCR for the specific amplification of the nucleocapsid (N) gene of SARS-CoV-2 was performed using the One Step PrimeScript III RT-qPCR mix (Takara Bio Inc., Kusatsu, Japan) according to the manufacturer's protocol. The following sets of primers and probe were used: forward primer (2.4 μM), 5′-AAA TTT TGG GGA CCA GGA AC-3′; reverse primer (3.2 μM), 5′-TGG CAG CTG TGT AGG TCA AC-3′; and 0.4 μM probe, 5′-FAM-ATG TCG CGC ATT GGC ATG GA-BHQ-3′. Thermal cycling was carried out as follows: reverse transcription at 52 °C for 5 minutes, initial denaturation at 95 °C for 10 seconds, 45 cycles of denaturation at 95 °C for 5 seconds, and a final annealing/extension at 60 °C for 30 seconds.
9
SARS-CoV-2 Quantification in Infected Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantification of SARS-CoV-2 in the supernatant of infected cells, RNA extraction and RT-qPCR were performed using the SARS-CoV-2 Direct Detection RT-qPCR kit according to the manufacturer's instructions (Takara Bio Inc., Kusatsu, Japan); Eight µl of the supernatant was used in a 20 µl-reaction. The RNA genome quantity was determined using the new coronavirus positive control RNA (Nihon Gene Research Laboratory, Sendai, Japan) as a standard. Cellular RNA in the infected VeroE6/TMPRSS2 cells was prepared using the Maxwell RSC instrument (Promega Corp., Madison, WI) according to the manufacturer’s protocol. RT-qPCR for specific amplification of the N gene of SARS-CoV-2 was performed using One Step PrimeScript III RT-qPCR mix (Takara Bio Inc.) according to the manufacturer's protocol. The Primer/Probe Set (2019-n) (Takara Bio Inc.) contains two primer sets, N and N2, both annealing to the N gene of SARS-CoV-2. Thermal cycling was carried out as follows: reverse transcription at 52 °C for 5 min, initial denaturation at 95 °C for 10 s, 45 cycles of denaturation at 95 °C for 5 s, and a final annealing/extension at 60 °C for 30 s. LightCycler 480 System II (Roche Diagnostics K. K., Basel, Switzerland) was used as the instrument for the PCR reaction.
10
SARS-CoV-2 Infection in Syrian Hamsters
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Syrian hamsters (male, 4 weeks old) were purchased from Japan SLC. Baseline body weights were measured before infection. For the virus infection experiments, hamsters were anesthetized by intramuscular injection of a mixture of 0.15 mg/kg medetomidine hydrochloride (Domitor, Nippon Zenyaku Kogyo), 2.5 mg/kg butorphanol (Vetorphale, Meiji Seika Pharma) and 4.0 mg/kg alphaxaone (Alfaxan, Jurox). WT and R10/E796G/C799F viruses (104 TCID50 in 100 μl) or saline (100 μl) was intranasally inoculated under anesthesia. Oral swabs were collected at the indicated timepoints and body weight was recorded daily by 7 dpi. The viral RNA load in the oral swabs was determined by RT- qPCR. Total RNA was extracted from the oral swabs using a PureLink RNA mini kit (Invitrogen). The RNA was used as the template for RT-qPCR performed in accordance with the manufacturer’s protocol using the One Step PrimeScript III RT-qPCR Mix (Takara) and the following primers and probe: Forward, 5’-CAC ATT GGC ACC CGC AAT C-3’; Reverse, 5’-GAG GAA CGA GAA GAG GCT TG-3’; Probe, FAM-ACT TCC TCA AGG AAC AAC ATT GCC A-BHQ. These primers target the nucleocapsid gene of SARS-CoV-2. Fluorescent signals were acquired using a QuantStudio5 Real Time PCR System (Applied Biosystems).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!