Relative ER mRNA expression was analyzed by qPCR, which was performed using a Dice real time thermal cycler (Takara Bio) and SYBR Premix Ex Taq™ II (Takara Bio). PCR primers were designed from the NCBI entries of ERα (GenBank Accession No. HM545084.1), ERβ (AB003356.1), and Ef1α (MH020210) coding regions (Table 1 ). Each PCR mix contained 0.5 volume of SYBR Premix, 0.2 μM of each forward and reverse primer, and 50 ng of cDNA template. The initial 1-min denaturation was followed by 40 cycles of denaturation for 5 s at 95 °C, annealing, and extension for 1 min at 60 °C. To ensure the specificity of the PCR amplicons, the temperature of the sample was gradually increased from 60 to 95 °C during the last step of PCR, and the melting curve was analyzed. The primers were successfully tested in the various cDNA samples obtained from Japanese eels by evaluating that each primer should amplify a single product, which is reflected as a single peak in the melting curve analysis. Also, the efficiency of the amplification remained between 90 and 110%. The relative mRNA expression levels of target genes were calculated using the ΔΔCt method, and the reference gene was virtually defined as the average of the threshold cycles (Ct) for EF1α.
Thermal cycler dice real time
Manufactured by Takara Bio
Sourced in Japan
The Thermal Cycler Dice Real Time is a laboratory instrument used for DNA amplification and real-time detection. It performs polymerase chain reaction (PCR) processes, allowing for the rapid and precise replication of DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Sybr premix ex taq 2, by Takara Bio (4 mentions)
Primescript rt reagent kit, by Takara Bio (4 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Anti acetyl histone h3, by Merck Group (1 mentions)
Anti dykddddk antibody, by Fujifilm (1 mentions)
Anti histone h3, by Abcam (1 mentions)
Thunderbird sybr qpcr mix, by Toyobo (1 mentions)
8 protocols using thermal cycler dice real time
1
Quantifying ER mRNA Expression by qPCR
2
Quantifying Gene Expression via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time qPCR reactions were performed using the Dice real time thermal cycler (TaKaRa-Bio) and SYBR Premix Ex Taq™ II (TaKaRa-Bio). Gene specific primers used for qPCR were designed using Primer3 plus (Primer Biosoft) and are provided in Table S1 . Each PCR reaction mix contained 50% of SYBR Premix, 0.2 µM of each forward and reverse primer, and 2 µl of diluted cDNA template by nuclease-free water. The initial 1 min denaturation was followed by 40 cycles of denaturation for 5 s at 95 °C, annealing and extension for 1 min at 60 °C. To ensure the specificity of the PCR amplicons, the temperature of the sample was gradually raised from 60 to 95 °C as the last step of the PCR reaction and a melting curve analyzed. The primers were successfully tested in the different cDNA samples of the Japanese eel, evaluating that each primer should amplify a single product, reflected as a single peak in the melting curve analysis. The relative mRNA expression levels of target genes were calculated using the ΔΔCt method, and the reference gene was virtually defined as the average of the threshold cycles (Ct) for EF1α.
3
Quantitative Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression levels of the genes were assessed by quantitative reverse transcription PCR (qRT-PCR) with a Dice Real-Time thermal cycler and SYBR Premix Ex Taq II following the manufacturer’s protocol (Takara-bio). Diluted cDNA was used as a template in 25 μl of PCR-amplification reaction mixture containing 12.5 μl of SYBR Premix Ex Taq II (Takara-bio) and 1 μl of the 10 μM primer set. A dissociation curve analysis was also performed to confirm primer compatibility. The relative expression of the genes of interest was measured by the standard curve method with three biological replicates. SAND was used as a reference gene44 (link). The primer set used for qRT-PCR is described in Supplementary Table S2 .
4
Transcriptional Regulation Analysis via Northern Blot and ChIP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Northern blotting and chromatin immunoprecipitation (ChIP) were performed as described previously29 (link). DNA probes for fbp1 and cam1 were amplified by PCR using primer sets p37/p38 and p39/p40, respectively. Anti-histone H3 (Abcam), anti-acetyl histone H3 (millipore), and anti- DYKDDDDK antibody (Wako) were used for the ChIP analysis. DNA concentrations were quantified using Thermal Cycler Dice Real Time (Takara Bio) and THUNDERBIRD® SYBR qPCR Mix (TOYOBO). Primer sets p41/p42 at UAS2 and p43/p44 at the prp3 locus were used for quantitative PCR analysis. MNase digestion assays were performed as described previously16 (link).
5
Quantitative Analysis of lncRNA and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the frozen tissues of patients or treated cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer's protocol. Purified total RNA was reverse transcribed using the PrimeScript RT reagent kit (Takara, Japan). Quantitative real-time PCR (qPCR) of the top 5 lncRNAs was performed using the Power SYBR Green PCR Master Mix (lnRcute lncRNA qPCR detection kit) according to the manufacturer's guidelines. The specific lncRNA primers are listed in Table S2 . Quantitative real-time RT-PCR of the target genes was performed by specific gene primers using Thermal Cycler Dice Real Time (Takara Bio Inc.) according to the protocol. The specific gene primers are listed in Table S3 . The expression levels of mRNA were normalized to the internal control GAPDH and then calculated with the ΔCT method. All data were expressed as the mean ± standard error of the measurement from at least three experiments.
6
Quantitative RT-PCR Analysis of VEGF-A
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from treated HCC cell lines with Trizol reagent following the protocol. The mRNA was reverse-transcribed from 500 ng of total RNA with Prime Script RT reagent kit (Takara Bio Inc.). Quantitative real-time RT-PCR of VEGF-A was carried out by specific primers using Thermal Cycler Dice Real Time (Takara Bio Inc.) according to the protocol. The primers used for quantitative PCR are listed in Supplementary Table S1 .
7
RT-qPCR Analysis of Plant Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To perform the RT-qPCR analysis, total RNA was extracted from collected samples using Trizol reagent (Invitrogen, Carlsbad, CA, USA) for vegetative tissues and the hot borate method [29 (link)] for reproductive tissues. The cDNA was synthesized using the PrimeScript RT reagent kit (Takara Bio Inc., Kusatsu, Japan). RT-qPCR was performed using the SYBR Premix ExTaq II (Takara Bio Inc., Kusatsu, Japan) and the Thermal Cycler Dice Real Time (Takara Bio Inc., Kusatsu, Japan). Gene-specific primers used are shown in Supplementary Table S1 . Ubiquitin (SlUBQ, Solyc01g056940) was used as an internal control [14 (link)]. For each sample, the RT-qPCR analysis was performed on three biological replicates and three technical repeats. Statistical analysis was performed using the Microsoft Excel Statistics 2013 for Windows.
8
Quantitative Analysis of lncRNA and mRNA Expressions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the frozen tissues of patients using TRIzol reagent (Invitrogen, USA) following the manufacturer's protocol. Puri ed total RNA was reverse transcribed using the PrimeScript RT reagent kit (Takara, Japan). Quantitative real-time PCR (qPCR) of the 3 lncRNAs was performed using the Power SYBR Green PCR Master Mix (lnRcute lncRNA qPCR detection kit) according to the manufacturer's guidelines. The primers for the 3 lncRNA primers were as follows: LINC01497:forward: AAATCAAGGTGTTGGCTGGGCTAC, reverse: GTGTTGCTGGCTCCGAAGATGG; LINC02766: forward: AGGAAGTAGGCGGTGTGGAGTG, reverse: GACAGAGTGGGCGGGAGGAG; LINC02528, forward: ACCTACCGAGAGACCTCCAAACAG, reverse: ACCCCTCTTCATCTGGGCATCTG. Quantitative real-time RT-PCR of the 2 mRNAs was performed by speci c gene primers using Thermal Cycler Dice Real Time (Takara Bio Inc.) according to the protocol. The primers for the 2 genes primers were as follows: C20orf85, forward: GCCATGCCAGGGAAAGGAAGAG, reverse: GAAGGGTGACGCTGATGACTTGAG; CST1, forward: AGGAGGAGGATAGGATAATCCC, reverse: TCTTTGGTGGCCTTGTTATACT. The results were normalized to β-actin and then calculated with the ΔCT method, the primers were as follows: ACTB, forward: CCTGGCACCCAGCACAAT, reverse: GGGCCGGACTCGTCATAC. All data were expressed as the mean ± standard error of the measurement from at least three experiments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!