Taq plus master mix 2 dye plus

The IS1311 PCR restriction endonuclease analysis (REA) was performed as described previously, to identify the strain type of MAP [20 (link), 24 (link)–26 (link)]. Briefly, the extracted DNA was added in an IS1311 PCR mix containing 1 μM of primers M-56 (5′-3′ GCGTGAGGCTCTGTGGTGAA) and M-119 (5′-3′ ATGACGACCGCTTGGGAGAC) and Taq Plus Master Mix II Dye Plus (Vazyme Biotech Co., Ltd., China). 8 μl of the positive IS1311 PCR solution was digested for 2 h at 37°C in a 16 μl reaction, which contained 2 U of each endonuclease HinfI and MseI supplemented with buffers provided by the manufacturer (Takara, Japan). And the products were analyzed by gel electrophoresis with 2% agarose gel and observed under UV light (Alpha RED, ProteinSimple).

To further characterize the PEDV detected by the ORF3 sequencing, both strains of the plaque-purified viruses were subjected to next-generation sequencing. Libraries were constructed using the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina, San Diego, CA, USA), and these were sequenced on an Illumina HiSeq X Ten platform and 150 bp paired-end reads were generated. The libraries and sequencing were conducted by OE Biotech Co., Ltd. (Shanghai, China). In order to verify the sequences, a total of 27 overlapping fragments of PEDV were amplified using 2 × Taq Plus Master Mix II (Dye Plus) (Vazyme, Nanjing, China) as previously described [26 (link)], with a few modifications. The PCR products were gel purified and cloned into a pMD-18T vector (TaKaRa, Dalian, China) and the sequences were determined by the Beijing Genomics Institute (Guangzhou, China).