SimpleChIP® Enzymatic Chromatin IP Kit (Agarose Beads) (Cell Signaling Technology, Inc.) was used for the ChIP experiment. Proteins and nucleic acids in MAECs were cross-linked by treatment with a 1% formaldehyde solution. Then, MAECs were incubated with the protease inhibitor cocktail at 4°C and were collected for subsequent experiments. The cross-linked chromatin was extracted from MAECs by lysis buffer, followed by purification procedures and sonication. After being treated with RNase A and Proteinase K as required, the qualified chromatin sample was incubated at 4°C overnight with 1 × ChIP buffer supplemented with Twist1 antibody (Santa Cruz Biotechnology, Inc.). On the next day, the Protein G Agarose Beads were used for further immunoprecipitation and purification. Finally, the pellets were eluted and reverse cross-linked to release ChIP DNA, and then the DNAs were prepared and used for subsequent qRT–PCR. All protocol details were available in the manual. The primers for VEGFR2 used in ChIP–qPCR are listed in Supplementary Material Table III .
Simplechip enzymatic chromatin ip kit agarose beads
Manufactured by Cell Signaling Technology
Sourced in United States, China
The SimpleChIP® Enzymatic Chromatin IP Kit (Agarose Beads) is a laboratory equipment product designed for chromatin immunoprecipitation (ChIP) experiments. The kit provides reagents and materials necessary to extract, digest, and purify chromatin from cells or tissues, allowing for the identification and analysis of DNA sequences associated with specific proteins of interest.
Automatically generated - may contain errors
Lab products found in correlation
6 protocols using simplechip enzymatic chromatin ip kit agarose beads
1
Chromatin Immunoprecipitation of Twist1 in MAECs
2
Histone Acetylation Profiling in Diabetes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed using Simple ChIP Enzymatic Chromatin IP Kit (Agarose Beads) (Cell Signaling Technology, Danvers, MA, #22188), following the manufacturer’s protocol. After culturing at 5.5 or 25 mM glucose for 48 hours, ChIP was performed using anti-Histone4ac (Millipore, #17-630) or anti-IgG antibody as a control. The bound DNA fragments were amplified using Bmi1 promoter-specific primers. The primer sequences used in the ChIP-qPCR are shown in the Supplementary Materials .
3
BACH2 Chromatin Immunoprecipitation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SimpleChIP® Enzymatic Chromatin IP Kit (Agarose Beads) (Cell Signaling Technology) was used to perform the ChIP assay, according to the manufacturer's instructions. The assay was performed as previously described [30 ]. DNA was immunoprecipitated using an anti‐BACH2 (1 : 50) (Cell Signaling Technology).
The binding site of BACH2 was 5′‐CCTGCCTCAGCCTC‐3′. Primers were designed based on the sequence with a binding site, and control, as the NC, was designed based on the sequence without binding sites. Immunoprecipitated DNA from anti‐BACH2 was amplified by PCR with primers. The primers for each PCR set were as follows: 5′‐GTGTGCAGTGGTGCAATCTT‐3′ and 5′‐GGTGGAGCCCCATCTCTACT‐3′; control, 5′‐TCTGTGATAAGGGGTGAGATTTT‐3′ and 5′‐GGCCTTCTGCACTTGCTATT‐3′.
For each PCR, the corresponding input was taken in parallel for PCR validation.
The binding site of BACH2 was 5′‐CCTGCCTCAGCCTC‐3′. Primers were designed based on the sequence with a binding site, and control, as the NC, was designed based on the sequence without binding sites. Immunoprecipitated DNA from anti‐BACH2 was amplified by PCR with primers. The primers for each PCR set were as follows: 5′‐GTGTGCAGTGGTGCAATCTT‐3′ and 5′‐GGTGGAGCCCCATCTCTACT‐3′; control, 5′‐TCTGTGATAAGGGGTGAGATTTT‐3′ and 5′‐GGCCTTCTGCACTTGCTATT‐3′.
For each PCR, the corresponding input was taken in parallel for PCR validation.
4
ChIP Assay for Estrogen Receptor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Simple-ChIP Enzymatic Chromatin IP Kit (Agarose Beads) (Cell Signaling Technology, Danvers, MA, USA) was used for ChIP assay according to the manufacturer’s protocol. MSCs were incubated with or without either estrogen. A total of 9 μg of chromatin DNA was immunoprecipitated using anti-ERα (cat.no: sc-8002; Santa Cruz, CA, USA), monoclonal antibody, anti-H3K27me2 monoclonal antibody (cat.no: 9728; Cell Signaling, Danvers, MA, USA), and anti-H3K27me3 monoclonal antibody (cat.no: 9733; Cell Signaling, Danvers, MA, USA) at 1:50 dilution rate. IgG (cat.no: sc-2025; Santa Cruz, CA, USA) monoclonal antibody was used as a negative control. A total of 10% of DNA was used as input. ChIP assay was analyzed with quantitative PCR using qPCR 2X Master mix (Ampliqon, Denmark) and results were expressed using the percent input method: Percent input = (Primer Efficiency) ^ (CT input – CT IP sample) Percentage of input. qPCR conditions were 95 °C for 15 min, 95 °C for 30 s, 60 °C for 1 min, 72 °C for 1 min and 30 cycles, 72 °C for 10 min.
5
Chromatin Immunoprecipitation Protocol with qPCR Quantification
6
ChIP-qPCR Analysis of GPR17 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) assays were conducted using the SimpleChIP® Enzymatic Chromatin IP kit (Agarose Beads; Cell Signaling Technology subsidiary in China, Pudong, Shanghai, China) according to manufacturer instructions. De-cross-linked DNA samples were subjected to PCR amplification using forward (5′-CACGGAGCCTAAGTTCTGG-3′) and reverse (5′-TGAGGCTCAGGCAAATGAA-3′) primers targeting the GPR17 promoter. Precipitated DNA fragments were analyzed using qPCR. The signal obtained from each immunoprecipitation was expressed as a percentage of the total chromatin input. The following formula was used: input percentage (signal relative to input) = 2% × 2^ (C(T) 2% input sample C(T) IP sample).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!