Polymyxin agarose column

The current study was also approved by the Committee on the Ethical Handling of Research Animals of UFMG (protocol number 333/2015) (12/09/2015). L. infantum (MOM/BR/1970/BH46) was used. Parasites were grown at 24 °C in Schneider's medium (Sigma-Aldrich, St. Louis, MO, USA), which was added with 20% heat-inactivated fetal bovine serum (FBS, Sigma-Aldrich) and 20 mM l-glutamine, pH 7.4. BALB/c mice (female, 8 weeks age) were maintained under specific pathogen-free conditions. The cloning, expression, and purification of the rSMP-3 protein was performed as described elsewhere [52 (link)]. After purification, the recombinant protein was passed on a polymyxin-agarose column (Sigma-Aldrich) to remove the residual endotoxin content (less than 10 ng of lipopolysaccharide per 1 mg of protein, measured by the Quantitative Chromogenic Limulus Amebocyte Assay QCL-1000, Bio-Whittaker, Walkersville, MD, USA).

The gene encoding ChimT was commercially synthesized in the pET28a-TEV vector by GenScript^® (Piscataway, NJ, USA). The recombinant protein was expressed in E. coli Artic Express cells (DE3, Agilent Technologies, Santa Clara, CA, USA) adding 1 mM of isopropyl β-D-1-thiogalactopyranoside (IPTG; Sigma-Aldrich, St. Louis, MO, USA), with shaking at 100 rpm for 24 h at 12 °C. The bacterial cells were ruptured by five cycles of ultrasonication of 30 s. each (38 MHz) followed by six cycles of freezing and thawing. Debris was removed by centrifugation and ChimT was passed over a HisTrap HP affinity column connected to an AKTA system (GE Healthcare, Boston, MA, USA) and further purified on a Superdex™ 200 gel-filtration column (GE Healthcare Life Sciences, Boston, MA, USA). The purified protein was then passed over a polymyxin-agarose column (Sigma-Aldrich, St. Louis, MO, USA) to remove any residual endotoxin content: less than 10 ng of lipopolysaccharide per 1 mg of protein was detected with the Quantitative Chromogenic Limulus Amebocyte Kit (QCL-1000 model, BioWhittaker, Walkersville, MD, USA) following the manufacturer’s instructions.

The region codifying the β-tubulin (XP_001468164.1) gene was cloned from the L. infantum genomic DNA by using the (GCTAGCATGCGTGAGATCGTTTCCTG) and (5′GAGCTCCTAGTAGGCCTCCTCCTC) primers. The PCR amplified products were analyzed on agarose gels, excised from the gels, purified, digested with restriction enzymes and ligated to the pET28a-TEV vector. The recombinant plasmid was introduced to Escherichia coli BL21 Arctic Express (DE3) cells (Agilent Technologies, Santa Clara, CA, USA) by electroporation using a MicroPulser Electroporation Apparatus (Bio-Rad Laboratories, Hercules, CA, USA). The recombinant protein was expressed by adding 1.0 mM IPTG (Promega, Madison, WI, USA) for 3 h at 37 °C, with shaking at 200× g per min. Cells were lysed by sonication by applying a continuous pulses of 30 s, with 15 s of interval between them, at 38 MHz, and centrifuged at 13,000× g for 20 min at 4 °C. The purified protein was passed on a 5 mL HIS-Trap column (GE Healthcare Life Science) attached to an FPLC (GE Healthcare Life Science) system, and thus through a polymyxin-agarose column (Sigma), in order to remove residual endotoxin content. Aiming to evaluate the purity of the recombinant protein, bacterial total extracts before and after IPTG induction, as well as the purified recombinant protein (10 µg each) were submitted to a 10% SDS-PAGE.