Guinea pigs were infected with 1 000×LD50 of MARV/Ang-GA, or an equivalent dose of MARV/Ang. Four animals from each group were euthanized at 0, 3, 5 and 7 dpi for necropsy. Blood was sampled from anesthetized guinea pigs by cardiac puncture. Whole blood was collected in K2 EDTA plus blood collection tubes (BD Biosciences, Canada) for blood counts and stored in lysis buffer AVL (Qiagen, USA) for determination of viremia, and lithium heparin blood collection tubes (BD Biosciences, Canada) for blood biochemistry. Major organs including livers, spleen, kidneys and lungs were harvested from these animals at the same timepoints and stored in RNAlater for subsequent analysis.
Avl lysis buffer
Manufactured by Qiagen
Sourced in United States, Germany
The AVL lysis buffer is a key component in the sample preparation process for nucleic acid extraction. It functions to lyse biological samples, releasing the genetic material for subsequent purification steps. The buffer is designed to effectively disrupt cell membranes and inactivate RNases and DNases, ensuring the integrity of the extracted nucleic acids.
Automatically generated - may contain errors
Lab products found in correlation
Viral rna mini kit, by Qiagen (4 mentions)
Taqman fast virus 1 step master mix, by Thermo Fisher Scientific (2 mentions)
Lithium heparin blood collection tubes, by BD (1 mentions)
K2 edta plus blood collection tubes, by BD (1 mentions)
Tissue lysis buffer atl, by Qiagen (1 mentions)
Qiaamp viral rna extraction kit, by Qiagen (1 mentions)
Qiaamp dna mini extraction kit, by Qiagen (1 mentions)
Cfx384 touch real time pcr detection system, by Bio-Rad (1 mentions)
Tripure isolation reagent, by Merck Group (1 mentions)
Qiaamp viral rna kit, by Qiagen (1 mentions)
Luna universal one step rt qpcr kit, by New England Biolabs (1 mentions)
Cfx96 real time system c1000 touch thermal cycler, by Bio-Rad (1 mentions)
Genesys 10s uv vis spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Qiamp viral rna extraction kit, by Qiagen (1 mentions)
5 mm stainless steel bead, by Qiagen (1 mentions)
Qiaamp mini column, by Qiagen (1 mentions)
Tissuelyser lt equipment, by Qiagen (1 mentions)
Triton x 100, by MP Biomedicals (1 mentions)
Gf f membrane, by Cytiva (1 mentions)
Nuclisens magnetic extraction kit, by bioMérieux (1 mentions)
12 protocols using avl lysis buffer
1
Marburg Virus Infection in Guinea Pigs
2
Nucleic Acid Extraction from Arthropod Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DENV-2 RNA was extracted from FTA cards and Ae. aegypti mosquitoes using the Qiagen QIAamp Viral RNA extraction kit according to the manufacturer's protocol with the additional step of manually homogenizing mosquitoes in lysis buffer AVL (Qiagen, Valencia, California) with a plastic microtube pestle. All RNA was eluted in 60 μl AVE buffer and stored at -80°C or used immediately.
Plasmodium falciparum NF54 DNA was extracted from FTA cards and An. stephensi mosquitoes using the Qiagen QIAamp Mini DNA extraction kit according to the manufacturer's protocol for tissue samples with the additional step of a 15 min incubation of the FTA card in tissue lysis buffer ATL (Qiagen, Valencia, California). All DNA was eluted in 50 μl of molecular biology grade water and then stored at -80°C or used immediately.
Plasmodium falciparum NF54 DNA was extracted from FTA cards and An. stephensi mosquitoes using the Qiagen QIAamp Mini DNA extraction kit according to the manufacturer's protocol for tissue samples with the additional step of a 15 min incubation of the FTA card in tissue lysis buffer ATL (Qiagen, Valencia, California). All DNA was eluted in 50 μl of molecular biology grade water and then stored at -80°C or used immediately.
3
Quantifying SARS-CoV-2 RNA via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from cell culture supernatants and cell lysates using TriPure isolation reagent (Sigma-Aldrich). Equine arteritis virus (EAV) in AVL lysis buffer (Qiagen) was spiked into the reagent as an internal control for extracellular RNA samples. The cellular household gene PGK1 served as a control for intracellular RNA. Primers and probes for EAV and PGK1 and the normalization procedure were described before (38 (link)). Viral RNA was quantified by RT-qPCR using TaqMan Fast Virus 1-step master mix (Thermo Fisher Scientific). Primers and probes were used as described previously (41 ) but with modifications that resulted in the following primer and probe sequences: for SARS-CoV-2 N-Gene, Fwd CACATTGGCACCCGCAATC, Rev GAGGAACGAGAAGAGGCTTG, and probe YakYel (5′ Yakima Yellow)-ACTTCCTCAAGGAACAACATTGCCA-black hole quencher 1 (BHQ1); for RdRp-Gene, Fwd GTGARATGGTCATGTGTGGCGG, Rev CARATGTTAAASACACTATTAGCATA, and probe FAM (6-carboxyfluorescein)-CCAGGTGGAACMTCATCMGGWGATGC-BHQ1. A standard curve of 10-fold serial dilutions of a T7 RNA polymerase-generated in vitro transcript containing the RT-qPCR target sequences was used for absolute quantification. A RT-qPCR program of 5 min at 50°C and 20 s at 95°C, followed by 45 cycles of 5 s at 95°C and 30 s at 60°C, was performed on a CFX384 Touch real-time PCR detection system (Bio-Rad).
4
SARS-CoV-2 RNA Isolation and RT-qPCR Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
On d0 after the third wash with PBS, as well as on days 1, 3, and 5 postinfection, a 30 min wash with PBS was performed from apical to harvest SARS‐CoV‐2 RNA for the RT‐qPCR analysis, as previously described.[127 , 128 ] SARS‐CoV‐2 RNA was isolated from the apical wash samples via AVL lysis buffer (Qiagen, 19073) and the QIAamp Viral RNA Kit (Qiagen, 52904) following the instructions of the manufacturer. The RNA yield was quantified via absorbance measurement on a Genesys 10S UV‐vis spectrophotometer (Thermo Fisher Scientific). After that a one‐step RT‐qPCR reaction was performed using the Luna Universal One‐Step RT‐qPCR Kit (New England Biolabs, E3006L) as well as a CFX96 Real‐Time System, C1000 Touch Thermal Cycler (Bio‐Rad). Primers, adapted from,[129 ] which target the open reading frame for RNA‐dependent RNA polymerase (RdRp): RdRP_SARSr‐F2 (GTG ARA TGG TCA TGT GTG GCG G) and RdRP_SARSr‐R1 (CAR ATG TTA AAS ACA CTA TTA GCA TA) were used in a concentration of 0.4 × 10−6 m per reaction.
5
Mosquito RNA Extraction for Viral Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chilled, sterile 1X phosphate-buffered saline (PBS) and sterile glass beads were added to each sample. Each 1 mL sample was homogenized in a Bullet Blender (speed 8, 5 min) with repeated cooling on ice/cold block. Samples were centrifuged (3,750xg, 3 min) and 140 µL of the homogenate supernatant was added to AVL lysis buffer (560 µL) (Qiagen). RNA was extracted using the QIAmp Viral RNA extraction kit (Qiagen) following the manufacturer's protocols with 2 × 40 µL elution steps. One pool of 5 uninfected, laboratory reared Ae. aegypti (Orlando strain) mosquitoes was processed in parallel, serving as a negative extraction control to rule out contamination or spurious amplification.
6
Optimized Viral RNA Extraction from Liver Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was isolated from liver tissue samples using Qiagen Viral RNA Minikit following manufacturer instructions and including additional steps to avoid contamination as previously described by Faria et al, 2018 [7 (link)]. The first step consisted of homogenization of liver tissue using TissueLyser LT equipment (Qiagen). A ~2 mm diameter of tissue was cut using a disposable scalpel and added to a 2 mL Eppendorf tube containing a 5 mm stainless steel bead (Qiagen). 560 μl AVL lysis buffer (Qiagen) was added to each tube and the sample was homogenised for 5 min at 50 Hz followed by a 10 min incubation at room temperature. Samples were centrifuged at 1,200g for 2 min to pellet cellular material, and 500 μL of supernatant was transferred to a new tube containing 500 μL of 100% EtOH. RNA extraction was subsequently completed using kit. To avoid contamination between samples due to the high number of virions, regular glove changes were conducted and parafilm was used to seal the gap between collection tubes and QIAamp Mini columns (Qiagen) during centrifugation.
7
Viral RNA Extraction from Rectal Swabs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA extraction from rectal swabs was performed using a slightly modified version of the Qiagen Viral RNA Mini Kit protocol (Qiagen GmbH, Hilden, Germany). Firstly, 200 μL of each sample in 800 μL of AVL lysis buffer (Qiagen GmbH, Hilden, Germany) was heat inactivated at 70 °C for 10 min. After pulse vortexing and short centrifugation, samples in pools of seven comprising 100 μL of each sample were extracted by the subsequent steps outlined in the Qiagen Viral RNA Mini Kit protocol and eluted in a final volume of 100 μL.
8
Rapid Multiplex Sequencing of Influenza
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Multiplex sequencing libraries were prepared using 200 fmol of cDNA from every six samples as input to the SQK-LSK109 Kit, barcoded using the EXP-NBD104 Native barcodes (ONT). One Library was sequenced on FLO-MIN106 flow cells on a GridION device (ONT), with sequencing proceeding for 48 h. Samples for which sequencing did not produce reads of internal control Hazara genome were associated with low quantities of total cDNA and so were repeated with the addition of 5 μg linear polyacrylamide carrier (Thermo Fisher, Waltham MA, United States) to the AVL lysis buffer (Qiagen, Hilden, Germany).
The sample processing and library preparation time was 8 h, the sequencing time was 48 h, and thus total turnaround time for each sample was < 72 h. With a team of three members, we prepared the sequencing libraries for 180 samples within 9 days and completed the sequencing for the 90 influenza-positive samples within 12 days of commencing sequencing (Supplemental Figure S1). The turnaround time is dependent on the capacity of the laboratory, the hardware being used (e.g. MinION or GridION) and the time over which data are collected from the flow cells.
The sample processing and library preparation time was 8 h, the sequencing time was 48 h, and thus total turnaround time for each sample was < 72 h. With a team of three members, we prepared the sequencing libraries for 180 samples within 9 days and completed the sequencing for the 90 influenza-positive samples within 12 days of commencing sequencing (Supplemental Figure S1). The turnaround time is dependent on the capacity of the laboratory, the hardware being used (e.g. MinION or GridION) and the time over which data are collected from the flow cells.
9
SARS-CoV-2 RNA Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was extracted from 140 μL of pharyngo-tracheal swabs medium. Viral RNA extraction was performed by using the Qiagen Viral RNA mini kit according to the manufacturer’s instructions (Qiagen, Les Ulis, France), with minor modifications. To inactivate potential infectious status of samples by SARS-CoV-2, a volume of 15 μL of Triton X-100 (MP Biomedicals, Illkirch, France) was added to 560 μL of AVL Lysis buffer (Qiagen, Courtaboeuf, France) for each sample testing. RNA was eluted in a final volume of 60 μL and stored at < −70°C. A negative RNA extraction control was performed for each set of 24 samples tested.
10
Viral RNA Extraction from Aquatic Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Water samples were treated with methods described by Maunula et al. (2012) with some modifications. In general, 5 l of the seawater samples were prefiltered through a Waterra ® filter (FHT-700) (Powell et al. 2000) , but in some cases, only 1 or 3 l could pass through the filter. Filtering was continued through a GF/F membrane (Whatman International). Virus particles were eluted from the Waterra filter using 50 ml of 50 mM glycine-3% beef extract (pH 9.5) and from the GF/F membrane with 1 ml AVL lysis buffer (Qiagen) after shaking for 10 min at room temperature. Both eluates were subjected to RNA extraction with a Viral RNA Mini Kit (Qiagen). Aquarium water from the infection trials and the liquid waste samples were not filtered. For determining the presence of VHSV, 140 µl of each sample were collected for RNA extraction with a Qiagen Viral RNA Mini Kit. Sediment samples were diluted by taking 5 g of each sample and adding 1 ml of phosphate-buffered saline. Suspensions were briefly stirred, and 200 µl of the liquid were taken for RNA extraction, which was performed using a Nu clisens magnetic extraction kit (Biomérieux). RNA was analysed using qRT-PCR both undiluted and in 1:10 dilution (RNase-free water).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!