Taq buffer

For absolute quantification, a plasmid carrying the phage terL gene fragment (named as Ter-plasmid) was constructed and used as the standard curve. Specifically, a pair of PCR primers was designed using Primer Blast to amplify a 721 bp region of the phage terL gene (GenBank accession NC_000948), embracing the 147-bp Ter-qPCR product region. The primers were FTer721:AGACTAAGATGCGGGCAAGA and RTer721:TTGCATCAAGAGCGTCATCA. PCRs were carried out in a LabCycler (SensoQuest GmbH) in a total volume of 50 μl, containing 0.25 mM dNTPs, 3 mM MgCl₂, 3 μM primers, 50 ng template DNA, 0.5 unit of Taq polymerase (Bioline), and 5 μl 10 × Taq buffer (Bioline). Amplification conditions were: 94°C for 2 min, 30 cycles of 94°C for 30 s, 50°C for 30 s, 72°C for 1 min, with a final extension of 10 min at 72°C. PCR products were gel-purified using a Qiagen gel extraction kit, and subjected to cloning using the NEB^® PCR Cloning Kit according to the manufacturer’s instructions. The recombinant Ter-plasmid DNA carrying the 721-bp terL gene was purified using the Qiagen Plasmid Kit from positive clones. The concentration of the Ter-plasmid was converted into DNA copy number on 20 January 2018 (Staroscik, 2004 ).

Polymerase chain reaction (PCR) amplification was accomplished by mixing 1.50 μl of 50 mM MgCl2 (BIOLINE Massachusetts, USA), 2.00 μl of 2.50 mM dNTPs (BIOLINE, Massachusetts, USA), 0.20 μl 500 U Taq DNA polymerase (BIOLINE, Massachusetts, USA), 1.0 μl of 10 μM each of ISSR primer pair, 15.05 μl of 500 ml diethylpyrocarbonate (DEPC)-treated water (INVITROGEN, Carlsbad, CA, USA) and 2.0 μL 100 ng DNA, 2.5 μl of 10 × Taq Buffer (BIOLINE, Massachusetts, USA) to make up a volume of 24.25 μL. The list of ISSR markers, their sequences, and annealing temperatures are presented in Table 4. The PCR cycling profile employed for the reaction entailed an initial step at 94 °C for 5 min, succeeded by 35 cycles of 94°C for 30 s, 72°C for 1 min, and a 10 min last extension at 72°C. For the PCR reaction, eight (8) μl of the PCR products were dispensed in a 1.5% agarose gel comprising 0.5 mg/ml ethidium bromide. The bands were photographed on Transilluminator UV light (Fotodyne Incorporated, Analyst Express, USA).