Agarose le

The 18 colistin-resistant isolates were sub-cultured in Luria–Bertani (LB) broth and grown overnight (Merck, Dramstadt, Germany). Then, plasmid DNA was extracted using the QIAprep^® spin miniprep kit (Qiagen, Hilden, Germany) as described in the manufacturer’s instructions. The concentration and purity of the eluted plasmid DNA were determined using the NanoDrop™ 2000c (Thermo Fisher Scientific, Waltham, MA, USA).
The presence of mcr-1 in the plasmid extracts was confirmed with PCR. The PCR reaction contained 0.5 $\mathsf{\mu }$ M of each primer (MCR1_22697 F1: cacttatggcacggtctatga, MCR1_22810 R1: cccaaaccaatgatacgcat) [65 (link)], 30 ng of DNA, 12.5 $\mathsf{\mu }$ L of A PCR master mix (Hot star Taq Plus, Qiagen, Hilden, Germany), 1x of gel loading dye (CoralLoad, Qiagen, Hilden, Germany), and DEPC-treated water up to a volume of 25 $\mathsf{\mu }$ L. The reactions were amplified in a Thermal Cycler using the following program: denaturation at 95 °C for 15 min; 25 cycles of 95 °C for 30 min, 58 °C for 90 min, and 72 °C for 1 min; and a final extension at 72 °C for 10 min. The amplified PCR products were subjected to electrophoresis in a 1.2% agarose gel (AgaroseLE, Ambion^®, Austin, TX, USA) stained with ethidium bromide (Promega, Madison, WI, USA). The gel was visualized using a Molecular Imager^® Gel Doc™ XR System 170–8170 (Bio-rad, Hercules, CA, USA).

DNA was extracted from bacterial cultures using QIAamp® UCP pathogen mini Kit (Qiagen, Germany) following manufacturer’s instructions. Extracted DNA was then used to run PCR for seven genes and using previously published primers [19 (link), 20 (link)] . The conditions used for ^blaTEM and ^blaSHV reactions were as follows: PCR mixture was made in volume of 20 μl containing 0.5 μM of each primer, 50 ng DNA, 1× master mix (Hot star Taq plus master mix (Qiagene, Germany)) and DPEC H2O up to 20 μl. The reaction was amplified in GeneAmp* PCR system 9700 thermocycler under the following conditions: 1. Initial denaturation at 96 °C for 5 min.; 2. 32 cycles consisting of denaturation at 96 °C for 30 s., annealing at 44 °C (^bla TEM) and at 58 °C (^bla SHV) for 45 s, and extension for 60 s. at 72 °C; and 3. A final extension cycles at 72 °C for 10 min. Multiplex PCR (MPCR) was performed in a final volume of 30 μl containing 0.23 μM of each primer (^bla CTX-M-G_{(1,2,8,9 &25)}), 50 ng DNA, 1× master mix (Hot star Taq plus master mix (Qiagene, Germany) [19 (link)]) and DPEC H2O up to 30 μl to screen for ^bla CTX-M- G (1,2,8,9 & 25) genes. Amplified products were subjected to electrophoresis in 1.2% agarose (Agarose- LE, Ambion®, USA), stained with ethidium bromide (Promega, Madison, USA) and visualized using Bio-Rad gel doc system (Bio - rad, Gel Doc ^tm XR System 170–8170, Canada).

PCR reactions were carried out using the HotstarTaq plus master mix kit (Qiagen, Hilden, Germany). The reaction mix was prepared as 25 µL of HotStarTaq Master Mix, 7 µL of RNase-free water, 5 µL of genomic DNA, and 1 µL (2 µM) of each primer, mecA, and spa genes. The primers were as follows: MecA forward primer: 5′AAAATCGATGGTAAAGGTTGGC 3′; mecA reverse primer: 5′ AGTTCTGGAGTACCGGATTTGC 3′; spa forward primer: 5′ TAAAGACGATCCTTCGGT GAGC 3′; and spa reverse primer: 5′ CAGCAGTAGTGCCGTTTGCTT 3′ [26 (link)]. The reaction was amplified using Biometra TAdvanced thermal cycler (Biometra, Göttingen, Germany) under the following conditions: initial denaturation at 95 °C for 10 min. This is followed by 40 amplification cycles for mecA gene and 35 cycles for spa gene, consisting of denaturation at 95 °C for 30 s, annealing at 53 °C (mecA gene) and 50 °C (spa gene) for 30 s, and extension at 72 °C for 1 min. Then, the final extension is at 72 °C for 10 min. After that, 5 µL of PCR-amplified products were subjected to electrophoresis in 1.2% agarose (Agarose- LE, Ambion^®, New York, NY, USA) and visualized using iBright™ CL1000 Imaging System (Thermo Fisher, New York, NY, USA).

Independent Lys⁺ colonies were patched on SD-LYS plates, and their DNA was extracted from a 5-mL SD-LYS liquid culture saturated overnight. DNA was digested by HindIII (for the interchromosomal donor construct), PstI (for the ectopic S2 70-bp donor construct), or PstI + EcoRI (for the ectopic S2 1000-bp donor construct) for 4 h at 37°C and migrated overnight in 0.8% agarose-LE (Affymetrix) in 1× TBE at 50 V. The DNA was transferred from the gel onto an Amersham Hybond-XL membrane (GE healthcare) following the manufacturer's instructions (alkali protocol). The membrane was blocked with Church buffer (1% BSA, 0.25 M Na₂HPO₄ at pH 7.3, 7% SDS, 1 mM EDTA) for 2–3 h at 65°C. The LY, S2, or LYS2 probes (2, 2, and 4 kb long, respectively), together with phage λ DNA (molecular ladder), were radiolabeled by random priming with 6000 Ci/mmol P³²-αdCTP (Perkin-Elmer) using the Decaprime II kit (Ambion, Inc.) and incubated with the membrane overnight at 65°C. After three to five washes for 10 min at 65°C (20 mM Na₂HPO₄ at pH 7.3, 1% SDS, 1 mM EDTA), membranes were exposed for 8–24 h, and the storage phosphor screen (GE healthcare) was scanned on a Storm phosphorimager (Molecular Dynamics).

An agarose (Agarose-LE, Affymetrix Inc., CA, USA) gel block was soaked with 10% sucrose solution and placed near the tip region of the partially fixed proboscis (Fig. 5c). The butterfly touched the wet agarose gel with the dorsal side of its proboscis after a few seconds. The agarose gel was then carefully detached from the proboscis tip using micro-forceps. This process was recorded by an inverted microscope (Axiovert 200, Carl Zeiss, Oberkochen, Germany) equipped with a CCD camera (Sensicam, PCO, Kelheim, Germany).

All of the organic solvents used were analytical grade and purchased from RCI Labscan (Bangkok, Thailand). Ultrapure grade dimethyl sulfoxide (DMSO) was purchased from Ameresco® (Framingham, USA). Testosterone (T) and 5α-dihydrotestosterone (5α-DHT) were purchased from Sigma-Aldrich (St. Louis, USA). Dutasteride was purchased from BDG Synthesis (Wellington, New Zealand). Agarose-LE was purchased from Affymetrix (Santa Clara, USA). Mesenchymal stem cell medium and its supplements were purchased from Sciencell Research Laboratories (Carlsbad, USA). Foetal bovine serum, 100X antibiotic-antimycotic solution, 10X PrestoBlue®, RPMI medium, 50X Tris-acetate-EDTA (TAE) buffer, 0.25 % trypsin-EDTA and Platinum® Taq polymerase were purchased from Invitrogen (Grand Island, USA). A GeneRuler 1-kb DNA ladder was purchased from Thermo Fisher Scientific (Pittsburgh, USA). RNeasy® mini kits were purchased from Qiagen (Valencia, USA). DNase I enzyme, first-strand cDNA synthesis kit, dATP, dTTP, dCTP and dGTP were purchased from Fermentas (Walthan, USA).

To make normal agarose gel, 2 g or 6 g of agarose powder (Agarose-LE, Affymetrix Inc., USA) was put into a beaker with 98 g or 94 g of deionized water. To make TiO₂ added agarose gel, 0.2 g of TiO₂ nanoparticles (Diameter was 21 nm, Degussa P25) were added to the solution and the solution was sonicated for 30 min. Next, these solutions were heated until the agarose powder was dissolved. Once it dissolved, the solution was poured into a cylindrical shaped mold. After gelation, the prepared agarose gels were stored in deionized water to prevent drying. To make a cryo-agarose gel, the agarose gel was frozen at −35 °C for 1 hr to allow the water molecules to form coarse ice clusters. (Supporting Information) Then, the frozen agarose gel was stored in DI-water, the ice clusters melted, and the microchannels were randomly shaped in the agarose gel.