Random primer

Purification of total RNA from cells was done with miRNeasy Kit (Qiagen) according to the manufacturer's protocol as shown previously after transfection of cultured human podocytes with either control siRNA or MITF siRNA. Reverse transcription was done with 1 µg RNA, Oligo(dT)primer (Promega, Madison, WI, USA), and Random primer (Promega) that were incubated at 70°C for 10 min followed by an incubation with M-MLV RT buffer (Promega), dNTPs (Roche, Mannheim, Germany), and M-MLV reverse transcriptase (Promega) at 42°C for 90 min and at 70°C for 10 min. For mRNA targets, we used sybr green-based real-time PCR with the following protocol: 1 min at 95°C followed by 35 cycles of 10 s at 95°C, 10 s at 60°C and 10 s at 72°C followed by 5 s at 95°C and 1 min at 65°C.
Sequences of human MITF primers were: forward primer 5′→3′ TACCACATACAGCAAGCCCA; reverse primer 5′→3′ACGCTCGTGAATGTGTGTTC.
Sequences of human INF2 primers were: forward primer 5′→3′GCCAAGAAGAGCCTGAACCT; reverse primer 5′→3′TCAATCTCGTGCTTCTCGG.
Sequences for zebrafish inf2 primers were: forward primer 5′→3′ TGGCATTCACTTCATCGTGGA; reverse primer 5′→3′ TGGACGTATCCAAAGCTTGC.
Sequences of human HPRT primers were: forward primer 5′→3′CAGTCCCAGCGTCGTGATTA; reverse primer 5′→3′ AGCAAGTCTTTCAGTCCTGTC3.

For mRNA reverse transcription 1µg RNA, Oligo(dT)primer (Promega, Madison, WI, USA), and Random primer (Promega, Madison, WI, USA) were incubated at 70 °C for 10 min followed by an incubation with M-MLV RT buffer (Promega, Madison, WI, USA), dNTPs (Roche, Mannheim, Germany), and M-MLV reverse transcriptase (Promega, Madison, WI, USA) at 42 °C for 90 min and at 70 °C for 10 min.
Sybr green-based real-time PCR was performed with the following protocol: 1 minute at 95 °C followed by 35 cycles of 10 seconds at 95 °C, 10 seconds at 60 °C, and 10 seconds at 72 °C followed by 5 seconds at 95 °C and 1 minute at 65 °C. Individual samples were run in triplicate.

The TRIzol reagent (Invitrogen, Buenos Aires, Argentina) was used to extract the total RNA of the mononuclear cells obtained from the bone marrow of the patients and the healthy control subjects. RT-PCR was performed with 1X reverse transcription (RT) buffer (Promega, Madison, WI, USA), 200 U/µL Moloney murine leukemia virus RT (Promega), 250 ng/µL random primer (Promega), and 10 mmol/L of each dNTP (Invitrogen). The cDNA synthesis with 1 µg of the total RNA was processed in a total volume of 20 µL for 10 min at 95 °C, 60 min at 37 °C, and 10 min at 95 °C to inactivate the enzyme. The obtained cDNA was stored at -20 °C until use.

The cDNA synthesis was performed using 1 μg of total RNA and random primer (Promega), at the following temperatures: 65°C for 5 min, 25°C for 10 min, 42°C for 50 min and 70°C for 15 min. The forward and reverse primers used to detect HMGA2 are as follows: F-huHMGA2: 5′-CACTTCAGCCCAGGGACAACC-3′; R-huHMGA2: 5′-CCTCTTCGGCAGACTCTTGTGA-3′. PCR conditions constituted an initial denaturation for 3 min at 95°C, followed by 40 cycles of denaturation at 95°C for 1 min, annealing at 63°C for 1 min and extension at 72°C for 2 min. The PCR was completed with a final extension step at 72°C for 10 min.