Absolute qpcr rox mix

Cells were harvested on day 14 post-transduction. Genomic DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen) as per manufacturer’s instruction. VCN were determined by TaqMan-based quantitative real-time PCR using primers and probes specific to the WPRE sequence of the vector (WPRE_FW 5’- TGGATTCTGCGCGGGA -3’, PRE_RV 5’- GAAGGAAGGTCCGCTGGATT -3’, PRE_probe 5’FAM-CTTCTGCTACGTCCCTTCGGCCCT-3’TAMRA and to the human albumin(ALB) reference gene (hALB_FW 5’-GCTGCTATCTCTTGTGGGCTGT-3’, hALB_RV 5’-ACTCATGGGAGCTGCTGGTTC-3’, hALB_probe5’-VIC-CCTGTCATGCCCACACAAATCTCTCC-TAMRA-3’). PCR reactions were carried out on a CFX96 Touch Real-Time System (Bio-Rad, Watford, UK) with ABsolute QPCR ROX Mix (Thermo Fisher Scientific) and the following PCR program: 15 mins at 95°C, followed by 40 cycles of 15 secs at 95°C/30sec at 60°C/1 min at 72°C. A standard plasmid carrying the WPRE and human albumin target sequences served for absolute quantification of the mean VCN per cell.

A piece of brainstem was cut from the brain hemispheres were snap frozen in liquid nitrogen and stored at −80 °C until use. A piece of brainstem was cut. Disruption and homogenization of the tissue was done using the TissueLyser (Qiagen). RNA was isolated with the RNeasy lipid tissue kit (Qiagen) according to the manufacturer’s protocol. cDNA synthesis was done from total RNA using the GoScript^TM Reverse Transcription System (Promega). Quantitative real-time PCR analysis was done with the Absolute qPCR ROX Mix (Thermo Scientific) and the Universal Probe Library (Roche) on an ABI7300 Real-Time PCR System (Applied Biosystems). Brainstems from Terc^+/+ mice were used as a reference. Primers were generated intron-spanning and primer sequences are mentioned in Additional file 1: Table S2.

Real-time PCR for TRPV1 and β-actin was performed with an ABI Prism 7900 System (Applied Biosystems) using the Absolute Q-PCR ROX Mix (Thermo Fisher Scientific, Waltham, MA, USA). The transcript copy number of TRPV1 was determined by absolute quantification following a previously reported method [24 (link), 25 (link)] using J probe (patent number: 201810845605.9). The expression level was calculated based on an internal standard, β-actin. Correlations between TRPV1 levels and demographical features were assessed using Mann–Whitney rank sum and Kruskal–Wallis one-way analysis of variance tests. Kaplan–Meier survival curves and log-rank tests were used to evaluate differences in OS.

cDNA was synthesized with a mix containing random hexamers, oligo(dT)15 (Promega) and SuperScript II reverse transcriptase (Invitrogen). Transcripts were quantified by real-time quantitative reverse transcription PCR on Light Cycler 480 (Roche) with Applied Biosystems predesigned TaqMan Gene Expression Assays and Absolute qPCR ROXmix (Thermo Fisher Scientific). All cycle thresholds (Cts) were normalized to the housekeeping gene B2M (beta 2 microglobulin) by subtracting the target gene Ct from the housekeeping gene Ct. In that way, the qPCR data are represented as a raw delta Ct value, which is a log2 relative expression scale. This simple way to calculate relative expression values enables direct comparison of expression differences between two conditions in qPCR and the log2 Affymetrix values. The following gene expression assays were used: ATP5O: Hs00426889_m1; CCL3: Hs00234142_m1; CCL4: Hs99999148_m1; CCL5: Hs00982282_m1; CCND2: Hs00277041_m1; CD86: Hs00199349_m1; CXCL10: Hs00171042_m1; CXCL11: Hs00171138_m1; DUSP6: Hs01044001_m1; EEF1A1: Hs00742749_s1; FOXP1: Hs00212860_m1; GJA1: Hs00748445_m1; ICOSLG: Hs00323621_m1; IFNA2: Hs00265051_s1; IL1B: Hs00174097_m1; IL6: Hs00174131_m1; IL8: Hs00174103_m1; NDUFA1: Hs00244980_m1; TNF: Hs00174128_m1; TNFRSF17: Hs00171292_m1 and B2M: Hs99999907_m1.