Microarray data were verified by quantitative real time PCR. Briefly, First-strand cDNA was synthesised using random hexamer primers and the GoScript Reverse Transcriptase System (Promega), and qPCR was performed using the SYBR green PCR protocol (Applied Biosystems) on the Chromo4 real-time PCR system (Bio-Rad). Primer sequences are presented in S5 Table . Each experiment included ‘no template’ controls, was run in duplicate and had an 18S RNA control. Each independent experiment was repeated three times, and the results were analysed by independent-samples t-test.
Sybr green pcr protocol
Manufactured by Thermo Fisher Scientific
Sourced in United States
SYBR Green PCR protocol is a laboratory technique used for the quantification of DNA sequences. It utilizes the SYBR Green dye, which binds to double-stranded DNA and emits a fluorescent signal that is proportional to the amount of DNA present. This protocol allows for the real-time monitoring of DNA amplification during the polymerase chain reaction (PCR) process.
Automatically generated - may contain errors
Lab products found in correlation
Reverse transcription kit, by Thermo Fisher Scientific (5 mentions)
Abi prism 7900ht sequence detection system, by Thermo Fisher Scientific (4 mentions)
Trizol system, by Thermo Fisher Scientific (4 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Primer express software 1, by Thermo Fisher Scientific (2 mentions)
Chromo4 real time pcr system, by Bio-Rad (1 mentions)
Goscript reverse transcriptase system, by Promega (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Model 680, by Bio-Rad (1 mentions)
Primer express software 2, by Thermo Fisher Scientific (1 mentions)
9 protocols using sybr green pcr protocol
1
Quantitative Real-Time PCR Verification
2
Submandibular Gland RNA Extraction and Quantitative PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The submandibular gland RNA was extracted using the TRIzol system (Life Technologies, Rockville, MD, USA). A reverse transcription kit (Applied Biosystems, Foster City, CA, USA) was used to perform reverse transcription according to the manufacturer’s protocol. RNA concentration was measured with NanoDrop® ND-1000 Spectrophotometers. The ratio of absorbance at 260 nm/280 nm is used to assess the purity of RNA. Quantitative PCR was performed according to the SYBR® Green PCR protocol (Applied Biosystems, Foster city, CA, USA). Reaction conditions were: 10 min at 95°C (one cycle); 10 s at 95°C; and 30 s at 60°C (40 cycles). Gene-specific PCR products were continuously measured by an ABI PRISM 7900 HT Sequence Detection System (PE Applied Biosystems, Waltham, CT, USA). Primer sequences can be found in Table 1 . Normalization consisted of using the differences between the cycle thresholds (delta CT) and the expression level for GAPDH to calculate the delta CT/target gene delta CT ratio.
3
Quantitative PCR Analysis of Rat Aortic Vasorin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-Time Quantitative Reverse Transcription PCR (q-RT-PCR) of rat aortic vasorin was performed according to modified methods as previously described [26 (link), 34 (link)]. Vasorin primer information: CTCA GCCACAGTCGTCTCC for the forward; and GA TGGGCAGCTCTGTACTCC for the reverse. In brief, RNA was extracted from frozen aortae or cultured VSMCs using Trizol reagent (Thermo Fisher Scientific, Halethorpe, MD). Real-time PCR was performed per the SYBRGreen PCR protocol (Applied Biosystems, Foster City CA). Each sample was tested in quadruplicate. Data are expressed using the formula: quantity=10–(Ct-Y intercept)/slope value) where Ct represents the threshold cycle value.
4
Gene Expression Analysis via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue RNA was extracted using TRIzol® reagent (Life Technologies Inc., Rockville, MD, USA). A reverse transcription kit (Applied Biosystems, Foster City, CA, USA) was used to perform reverse transcription according to the manufacturer’s protocol. Quantitative PCR was performed according to the SYBR® Green PCR protocol (Applied Biosystems). The reaction conditions were: 10 min at 95°C (one cycle); 10 s at 95°C; and 30 s at 60°C (40 cycles). Gene-specific PCR products were continuously measured by an ABI PRISM™ 7900 HT Sequence Detection System (PE Applied Biosystems, Waltham, CT, USA). The primer sequences are presented in Table 2 . Normalization consisted of using the differences between the cycle thresholds (delta CT) and the expression level for Gapdh to calculate the delta CT/target gene delta CT ratio.
5
Verification of mRNA Expression in Submandibular Gland
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To confirm mRNA expression, we isolated whole submandibular gland tissue and used real time PCR method. Tissue RNA was extracted using the TRIzol system (Life Technologies, Rockville, MD). Reverse Transcription Kit (Applied Biosystems, Foster City. California) was used to perform reverse transcription according to the manufacturer's protocol. Real-time PCR was performed according to the SYBR Green PCR protocol (Applied Biosystems Foster City CA). Gene-specific PCR products were continuously measured by an ABI PRISM 7900 HT Sequence Detection System (PE Applied Biosystem Norwalk, CT). All the primers used for Real Time PCR analysis have been designated using Primer Express software 1.5 (Applied Biosystems, Foster City, CA), and synthesized by Invitrogen Life Technologies (Carlsbad, CA). Primer sequences can be found in Table 1 .
6
Submandibular Gland RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Submandibular gland RNA was extracted using TRIzol (Life Technologies, Rockville, MD, USA). A reverse transcription kit (Applied Biosystems, Foster City, CA, USA) was used to perform reverse transcription, according to the manufacturer’s protocol. The RNA concentration was determined using a NanoDrop® ND-1000 spectrophotometer. The ratio of absorbance at 260 nm/280 nm was used to determine RNA purity. qPCR was performed according to the SYBR ® Green PCR protocol (Applied Biosystems, Foster City, CA, USA). The reaction conditions were: 10 min at 95 °C (one cycle), 10 s at 95 °C, and 30 s at 60 °C (40 cycles). Gene-specific PCR products were continuously measured using an ABI PRISM 7900 HT Sequence Detection System (PE Applied Biosystems, Waltham, CT, USA). The primer sequences are presented in Table 1 . The delta CT/target gene delta CT ratio was calculated via normalization by comparing the cycle threshold differences (delta CT) to the Gapdh expression level.
7
Vocal Fold Transcriptional Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To confirm mRNA expression, we isolated whole lamina propria of the vocal fold with a syringe needle under microscope and used the real time PCR method. Tissue RNA was extracted using the TRIzol system (Life Technologies, Rockville, MD, USA). A reverse transcription kit (Applied Biosystems, Foster City, CA, USA) was used to perform reverse transcription according to the manufacturer’s protocol. Quantitative PCR was performed according to the SYBR ® Green PCR protocol (Applied Biosystems, Foster city, CA, USA). Each sample was tested in quintuplicate. Reaction conditions were: 10 min at 95 °C (one cycle); 10 s at 95 °C; and 30 s at 60 °C (40 cycles). Final primer concentration was 0.1 μM and sequences can be found in Table 1 . Gene-specific PCR products were continuously measured by an ABI PRISM 7900 HT Sequence Detection System (PE Applied Biosystems, Waltham, CT, USA). All the primers used for qPCR analysis had been designated using Primer Express software 1.5 (Applied Biosystems, Foster city, CA, USA) and synthesized by Invitrogen. (Invitrogen Life Technologies, Carlsbad, CA, USA). Normalization consisted of using the differences between the cycle thresholds (delta CT) and the expression level for Rn18s to calculate the delta CT/target gene delta CT ratio. Delta/delta CT corresponds to the differences between the delta CT the internal control gene.
8
Verapamil Cytotoxicity Assay and Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For all experiments, cells were treated with various dosage of verapamil. After time period, cells were incubated with MTT at 37 °C for 4 h, and the precipitate was dissolved in DMSO. Subsequently, the absorbance (optical density, OD) at 570 nm was measured using a microplate reader (Model 680; Bio-Rad Laboratories, Hercules, CA, USA) and cell viability was calculated according to the % formula. Cellular RNA was extracted using the TRIzol system (Life Technologies, Rockville, MD). Reverse Transcription Kit (Applied Biosystems, Foster City. California) was used to perform reverse transcription according to the manufacturer's recommended reaction protocol. Real-time PCR was performed according to the SYBR Green PCR protocol (Applied Biosystems Foster City CA). Gene-specific PCR products were continuously measured by an ABI PRISM 7900 HT Sequence Detection System (PE Applied Biosystem Norwalk, CT). The information on primer sequences are as following Table 2 .
9
Aging-Associated mRNA Expression in Rat Aorta
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Messenger ribonucleic acid (mRNA) was extracted from the thoracic aortae or early passage VSMCs of individual young and old rats using the RNA precipitation kit (Qiagen, Germantown, MD, USA). RNA (200ng) was isolated according to the manufacturer's instructions (Applied Biosystems, Foster City, CA, USA). All the primers used for Real Time PCR (RT-PCR) analysis was designed using Primer Express software 2.0 (Applied Biosystems, Foster City, CA, USA), and synthesized by Thermo Fisher Scientific (Carlsbad, CA, USA). The following primer sequences were used: TPELN, forward ATCGGAGGTCCAGGCATTG; and backward ACCAGCACCAACCCCGTAT. MFG-E8, forward ACACACAGCGAGGGGACAT; and backward ATCTGTGAATCGGCAATGG. H1f0, forward AGCCACTACAAGGTGGGTGAGA; and backward TTGAGAACACCGGTGGTCACT. Real-time PCR was performed according to the SYBR Green PCR protocol (Applied Biosystems, Foster City, CA, USA). Each sample was tested in quadruplicate with the following reaction conditions: 10 min at 95°C (one cycle); 30 second (sec) at 95°C; 30 sec at 60°C; and 30 sec at 72°C (40 cycles). Gene-specific PCR products were continuously measured by an ABI PRISM 7900 HT Sequence Detection System (PE Applied Biosystem Norwalk, CT, USA). The PCR product sizes were verified by agarose gel electrophoresis. Samples were normalized to the expression of the "housekeeping" gene, H1F0.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!