Netprimer

Upon identification of a putative S. maltophilia-specific genetic target, sequence alignments were used to locate conserved regions. Although some variation was allowed within the amplicon, primer- and probe-binding regions required 100 % sequence identity in all S. maltophilia strains to avoid false negatives. Oligo self-dimers and heterodimers were assessed in silico using NetPrimer (NetPrimer/">http://www.premierbiosoft.com/NetPrimer/) and Beacon Designer (http://www.premierbiosoft.com/qOligo/Oligo.jsp/), with configurations resulting in ΔG values of <−8.0 (NetPrimer) and <−4.0 (Beacon Designer) excluded. The following sequences and probe label were chosen for the assay: Smalto-For 5′-AAGGACAAGGCGATGACCATC-3′, Smalto-Rev 5′-CCCCACCACGAYTTCATCA-3′ and Smalto-Probe 5′-FAM-CAGAACGACATCTGGTTGGCG-BHQ1-3′, resulting in an amplicon length of 344 bp. NCBI microbial nucleotide Discontiguous MegaBLAST (http://blast.ncbi.nlm.nih.gov/) analysis of this amplicon was used to determine assay specificity for only S. maltophilia. No mismatches in the probe-binding site were tolerated in any S. maltophilia strain, whereas ≥2 mismatches in the probe-binding site were considered sufficient for conferring S. maltophilia specificity.

To fill the gaps that remained after mapping Ion reads, we designed 11 primer sets (Table 4) against the NCBI MERS-CoV reference genome assembly (NC_019843.3). Primers were designed and checked using Primer Express software (v3.0) (Applied Biosystems, Foster City, CA, USA) and NetPrimer (Premier Biosoft, Palo Alto, CA, USA), with gap flanking regions incorporated into the primers. Sequences for all the major gaps were amplified by PCR using Platinum^TM Hot Start PCR Master Mix 2X (Thermo Fisher Scientific, Waltham, MA, USA). PCR products were sequenced using the BigDye^® Terminator Sequencing Kit (Applied Biosystems, Foster City, CA, USA) on an Applied Biosystems 3730xl DNA Analyzer. Most minor gaps were sample-specific; to ensure complete genome coverage for phylogenetic analysis, these gaps were closed manually after performing multiple sequence alignment (MSA) on the fully-sequenced genomes. MSA was carried out using Geneious software [34 (link)].

Primers were designed based on the sequence of 21 contigs showing in silico expression levels stable or variable among experimental modalities, and checked with NetPrimer (Premier Biosoft, Palo Alto, California). Amplification specificity and qPCR efficacy were checked for each contig as described [81 (link)]. Primer pairs retained for contig expression measurement had an efficiency value between 80 and 110 % (Additional file 3: Table S2). The expression level of the 21 contigs was measured in each of the 42 individual RNA samples used to create the 14 pooled samples subjected to RNA-Seq. Analyses were performed in duplicate (technical replicates) for each sample. Reverse transcription was performed using the Masterscript RT-PCR System kit (5 PRIME, Hamburg, Germany) starting from 5 μg total RNA. The StepOnePlus™ Real-Time PCR System Thermal Cycling Block (Applied Biosystems, Foster City, USA) was used to perform qPCRs in fast optical 0.1 mL, 96-well reaction plates (MicroAmp™, Applied Biosystems, Cheshire, UK). Reaction mixes, PCR programs, contig expression measurement and normalization with three previously validated reference genes using a five-point standard dilution curve were as described [81 (link)].

PanK RNAi forward and reverse primers were designed using NetPrimer (PREMIER Biosoft, San Francisco, CA) to knock down A. stephensi PanK transcript: PanK RNAi-F 5′ TAATACGACTCACTATAGGGAGAACGCTGACGAAGCTGGTGTA 3′ and PanK RNAi-R 5′ TAATACGACTCACTATAGGGAGACGGTGAGCAGACAGCACAG 3′ (T7 RNA polymerase promoter sequence is underlined). The expected amplicon (607 bp) was PCR amplified using Taq 2X Master Mix (New England Biolabs, Ipswich, MA, USA) with A. stephensi midgut cDNA as the template. Double stranded RNA (dsRNA) was synthesized using HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA). Cold-anesthetized female mosquitoes were intrathoracically microinjected twice with 276 nL dsRNA (8 μg/μL) using a Nanoject II microinjector (Drummond Scientific, Broomall, PA). The first injection was performed within 4 h of adult eclosion and the second injection was completed at 3 d post-eclosion. Injected mosquitoes were maintained on 10% sucrose throughout the experiments. Firefly luciferase dsRNA (dsRNA-FLuc) was synthesized and injected following the above protocol as a negative control [14 (link),15 (link)]. Injected mosquitoes were provided a blood meal at 5 d after adult eclosion; dissected midguts were collected for analysis immediately prior to blood feeding (NBF) and at 2, 6, and 24 h post-blood feeding.

Primer pairs were designed using Primer3. The main parameters were determined as followed: primer length 18–25 bp (optimum 20); GC content 40–60%, product size 100–200 bp (optimum 150 bp), melting temperature 60 ± 1 °C (temperature difference < 0.5 °C). The self-complementarity score was set to three with an increased value if no acceptable primers were found. Primer pairs were also tested by NetPrimer (PREMIER Biosoft International, Palo Alto, CA) to avoid hairpins, primer dimers and primer cross dimers. The 106 primer pairs were designed on the transcriptome of 'Golden Delicous' and corrected in the case of differences to the transcriptome of Mr5. Primer verification was performed firstly by Reverse Transcriptase-PCR (RT-PCR) (94 °C for 3 min/30 s, 57 °C for 1 min, 72 °C for 1.30/5 min, 30/35 cycles) with one biological replicate of each sample. Positively tested primer pairs were further analyzed by quantitative real-time qPCR (94 °C for 3/1 min, 61 °C for 1 min, 72 °C and 1 for, 40 cycles). To use primers in the BioMark HD System, the Ct value should not be higher than 35. The sequences of all primers used in this analysis are listed in Table S3.

The genomic structure of the GLTx gene was analyzed in genomic DNA of G. tridactyla, collected in April 2011 nearby the Roscoff marine station. DNA was extracted using the NucleoSpin® Tissue Kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocols. Based on transcriptome sequence information, primers were designed using NetPrimer (PREMIER Biosoft, Palo Alto CA; Additional file 12), and PCR experiments carried out. Unknown gene parts that are adjacent to known gene regions were determined using the GenomeWalker™ Universal Kit (Clontech Laboratories, Inc., Takara Bio Company, Mountain View, CA) [84 (link)]. Amplicons were purified using the NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel) according to the manufacturer’s protocols. Sanger sequencing was performed by the GATC Biotech AG (Constance, Germany).

NCBI Primer Blast was used to design primers for control housekeeping genes (Ywaz and Gapdh) [63 (link)] and genes of interest (Th, Gad1, Gad2, Gls, Glul, MuR) using the rat (Rattus norvegius) genome. Netprimer (PREMIER Biosoft, Palo Alto, CA, USA) was used to examine secondary structure of all primers. Non-template controls were run with each primer pair to check for formation of primer-dimers and non-specific amplification products. All primer runs yielded single peak melt curves (60°C) indicating amplification of single gene products. Sequences are provided in Table 2.