Dreamtaq green pcr master mix kit

After the incubation with 1 μM CORO, 0.1 g/L of baccatin III and 0.1 g/L of β-phenylalanine-CoA, the expression of the three genes was studied in the transfected protoplasts at 6 h of treatment. Total RNA was extracted from approximately 500 mg of protoplast pellet using the ARNzol kit (REAL, Valencia, Spain) and treated with Superscript IV Reverse Transcriptase (Invitrogen, Carlsbad, CA, United States) and the TURBO DNA-free kit (Thermo Fisher Scientific, Waltham, MA, United States) to obtain complete cDNA from 1 μg of total RNA. cDNA from the transfected protoplasts was amplified with specific primers for BAPT (forward: TGAGCGAGTCATGGTAGAC; reverse: AACCCCCACATGTAAAACGA), TB506 (forward: GGGAACGGGCAAGACATGG; reverse: GCCCACTCCATCGA CCACAG) and DBTNBT (forward: CGGGGGGTTTGTTGTGG GATT; reverse: CATTATCCATTGCACATG) using the Dream-Taq Green PCR Master Mix kit (ThermoFisher Scientific). The PCR conditions were: denaturation at 95°C for 5 min, 35 cycles of 95°C for 1 min, Tm (64°C for BAPT, 58°C for TB506 and 48°C for DBTNBT primers) for 1 min and 72°C for 1min, with a final step at 72°C for 5 min.

The PCR amplification of ovine BMPR1B gene was performed using a primer pair of Forward: 5′-GTC GCT ATG GGG AAG TTT GGA TG-3′ and Reverse: 5′-CAA GAT GTT TTC ATG CCT CAT CAA CAC GGT C-3′ (Wilson et al. 2001) [17 (link)]. According to that primer, the target sequence of BMPR1B gene is along 140 bp (Fig. 1). The PCR reaction was performed in a total volume 10 μL containing 1.2 μL of DNA template (2.18 ng/μL), 10 pmol/μL each of primer, 2 × of DreamTaq Green PCR mastermix kit (ThermoScientific, USA) and 3.6 μL of nuclease-free water. The PCR reaction was performed in a Mastercycler Gradient thermocycler (Eppendorf-Germany) with amplification program comprised of pre-denaturation (95 °C at 2 min); followed by 36 cycles of denaturation (95 °C at 30 s), annealing (56.6 °C at 1 min; 30 s), and extension (72 °C at 30 s); and final extension (72 °C at 2 min).Fig. 1

Primer position (underline) in the exon 8 of ovine BMPR1B gene (GenBank: GQ863576.1) along 140 bp. A Boorola (G or Fec.^B) allele was caused by the missence mutation of c.109A > G or p.Q36R (R)

Electrophoresis of PCR product (amplicon) was performed using 1% agarose at 100 V at 30 min. Amplicons were stained with GelRed (Biotium, USA) along 30 min and then visualized using G-Box documentation system (Syngene, UK).

Total RNA was extracted from brain tissue at 3 and 7 dpi with TRIzol reagent and reverse transcribed to cDNA using a RevertAid First Strand cDNA Synthesis kit (Thermo Scientific, Vilnius, Lithuania) (Yang et al., 2008 (link)). The PCR reaction (35 cycles) was performed using a DreamTaq Green PCR Master Mix Kit (Thermo Scientific). Quantitative RT-PCR was performed using the following forward and reverse primer sets designed using Premier Biosoft 5 (Palo Alto, CA, USA): TNF-α, 5′-ATA AGA GCA AGG CAG TGG AG-3′ and 5′-TCC AGC AGA CTC AAT ACA CA-3′;IL-6, 5′-AGC CAG AGT CCT TCA GAG AG-3′ and 5′-TCC TTA GCC ACT CCT TCT GT-3′; IL-10, 5′-TTC TCA TTC CTG CTT GTG GC-3′ and 5′-ATC TGA GTG TGA GGG TCT GG-3′; Bax, 5′-CTG ACA TGT TTT CTG ACG GC-3′ and 5′-TCA GCC CAT CTT CTT CCA GA-3′; Bcl-2, 5′-CGC TGG GAG AAC AGG GTA-3′ and 5′-GGG CTG GGA GGA GAA GAT-3′; Caspase-3, 5′-AGA TAC CGG TGG AGG CTG ACT-3′ and 5′-TCT TTC GTG AGC ATG GAC ACA-3′; and β-actin (control), 5′-GGG AAA TCG TGC GTG ACA T-3′ and 5′-TCA GGA GGA GCA ATG ATC TTG-3′. Products were resolved by 1.5% agarose gel electrophoresis with ethidium bromide staining. The mRNA levels of TNF-α, IL-6 and IL-10 were detected at 3 dpi, and those of Bax, Bcl-2, and caspase-3 were detected at 7 dpi. Quantitative analysis was performed using a Tanon 4100 Gel Imaging System (Tanon Science & Technology Co., Shanghai, China).

Carbon dioxide (CO₂, SFE grade), contained in a dip tube cylinder, was purchased from Air Products Sp, Poland. Methanol for HPLC-super gradient was purchased from POCh (Gliwice, Poland). Acetonitrile, methanol, and water for LC-MS grade were acquired from POCh (Gliwice, Poland). Dream Taq green PCR master mix kit was purchased from Thermo Scientific (Vilnius, Lithuania). Analytical standards including ERG, ZEN, DON, 15-AcDON, and 3-AcDON were purchased in ready-to-use solutions from Romer Labs (Tulln, Austria), and ZEN-14S (100 μg/mL) purchased in Aokin (Berlin, Germany). Depending on solubility, the standards were dissolved in acetonitrile. All standards were stored in amber glass vials at approximately −20°C. A mixture of all standards necessary for a particular analytical run was prepared immediately before the analysis.