Brilliant 2 sybr green

After 6 and 24 hpa, panther and wild-type larvae were euthanized by MS-222 overdose, larval tails were collected, and RNA was isolated using the RNAqueous-Micro kit (Ambion, Lithuania). cDNA from isolated RNA samples were generated using ImProm-II Reverse Transcription system (Promega, Madison, WI, USA), and qPCR was performed in a Stratagene Mx3000P system using Brilliant II SYBR Green as fluorescent detector (both from Agilent Technologies, Cedar Creek, TX, USA). Primers used were: il1b Fwd 5′-TGGACTTCGCAGCACAAAATG-3′ and Rev 5′-CGTTCACTTCACGCTCTTGGATG-3′ (27 (link)); tnfa Fwd 5′-CAAGGCTGCCATCCATTTAACAGG-3′ and Rev 5′-TCAGTTCAGACGTGCAGCTGAT-3′; tgfb1a Fwd: 5′- CAACCGCTGGCTCTCATTTGA-3′ and Rev 5′- ACAGTCGCAGTATAACCTCAGCT-3′ (19 (link)); il10 Fwd 5′- ACAGTCCCTATGGATGTCACGTCA-3′ and Rev 5′- GCATTTCACCATATCCCGCTTGAG-3′; ef1a Fwd 5′-AGAAGGAAGCCGCTGAGATG-3′ and Rev 5′-TGTCCAGGGGCATCAATAAT-3′ (27 (link)). For analysis, target gene expression was calculated using the 2^−ΔCt method (28 (link)), using ef1a as a reference housekeeping gene.

Total RNA was isolated from shoots and roots of N. benthamiana seedlings. Stem-loop cDNAs for specific miRNAs were synthesised from total RNA using the method according to Varkonyi-gasic and Hellens [63 ] with 100 ng total RNA and 2.5 U/μL SuperScript III reverse transcriptase (Life Technologies). Stem-loop RT-qPCR was performed using Brilliant II SYBR® Green (Agilent) according to the manufacturers’ directions. Poly(A)dT₂₃ cDNAs were synthesized using 1 μg total RNA and SuperScript III according to the manufacturer’s directions. RT-qPCR was performed as before. Nbe-UBC21 was used as a reference gene in both cases.

The HeLa cells were transfected in 10-cm plates. Translation was stimulated by changing the media 1.5 h before lysis. Cycloheximide in the amount of 0.1 mg/mL was added 10 mins before lysis. The cells were washed twice with 5 mL ice-cold PBS containing 0.1 mg/mL cycloheximide. The cells were collected in 300 µL PBS with cycloheximide, and the PBS was removed by centrifugation. The cells were resuspended in 550 µL polysome extraction buffer (15 mM Tris-HCl (pH 7.5), 15 mM MgCl₂, 300 mM NaCl, 1% Triton X-100, 1 mM DTT, 0.1 mg/mL cycloheximide and RNAsein (Sigma)). Cellular debris was pelleted by centrifugation at 17,000× g for 1 min at 4 °C. The supernatant in the amount of 500 µL was added to 10 mL 10–50% sucrose gradients (with the extraction buffer without Triton X-100). The gradients were centrifuged using an SW41 rotor at 223,000× g for 2 h at 4 °C. The gradient was collected in 1 mL fractions. RNA was extracted from the solution with an RNAeasy extraction kit (Qiagen) according to the manufacturer’s protocol. RNA was converted to cDNA using a Quantitect Reverse Transcription kit (Qiagen) on a SureCycler 8800 (Agilent) and an Mx3005P qPCR machine. Brilliant II SYBR Green (Agilent) was used to perform qPCR on an Mx3005P (Agilent).

Total RNA was extracted using GenElute kit (Sigma) and cDNA was prepared using the Affinity script cDNA synthesis kit followed by qPCR using Brilliant II SYBR Green (Agilent Technologies) and a MX3005P qPCR machine (Agilent Technologies). All amplifications were as follows: 95°C for 30 s, 58°C for 30 s, and 72°C for 60 s for 40 cycles. Primer sequences were designed using NCBI Primer-BLAST/Primer3 software and always spanned exon-exon junctions. Primer forward (F) and reverse(R) sequences 5′ to 3′ were: GAPDH-F:CCGCATCTTCTTTTGCGTCGC, GAPDH-R: AAATGAGCCCCAGCCTTCTCCATG, TPK1-F: TCGTGACACTGGGAGGCCTTG, TPK1-R: ACCTGTGCTTTCCTGGTTGGAGC, THTR1-F: ACCGAGAGGGAGGTCTTCAA, THTR1-R: AGCCCCTGCAGTAGAACAAC, TPC-F: GGAGCTAGAGAGAGCGGAGA and TPC-R: CATCAGTATCAAGATACGGTCTGT. Ct values were converted into relative copy number and normalized to GAPDH control.