After PROP-Z delivery, organs were harvested aseptically using surgical tools treated with a bead sterilizer and washed in ethanol and subsequently in sterile, DNA-free water before use in extracting tissues. A small tissue sample of 10 to 100 mg was excised from each organ and used for DNA isolated with an UltraClean Tissue & Cells DNA Isolation Kit (MoBio). One microliter of DNA sample was used in a subsequent qPCR experiment run according to the manufacturer’s parameters (Qiagen, QuantiTect SYBR Kit) on a Bio-Rad iCycler machine. We used specific primers for EcN (Muta 7/8) to quantify PROP-Z levels (63 (link)). Control curves were run for each qPCR experiment using a known amount of bacteria purified through the UltraClean Tissue & Cells DNA Isolation Kit. Automated Ct values generated from a Bio-Rad iCycler machine exhibit a linear correlation with the known number of bacteria across several orders of magnitude (fig. S3 ). Colony counts were obtained by excising whole organs, homogenizing in a tissue dissociator (Miltenyi), and plating on erythromycin to specifically detect the presence of EcN/PROP-Z. Comparisons of colony counting from tumors and qPCR experiments were correlated.
Icycler machine
Manufactured by Bio-Rad
Sourced in United States
The iCycler is a thermal cycler instrument designed for performing polymerase chain reaction (PCR) experiments. It is capable of precisely controlling the temperature and cycling parameters required for various PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Iq sybr green supermix, by Bio-Rad (7 mentions)
Sybr green reagent, by Bio-Rad (7 mentions)
Tri reagent, by Merck Group (6 mentions)
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Iscript reverse transcription supermix kit, by Bio-Rad (5 mentions)
First strand cdna synthesis kit, by Thermo Fisher Scientific (4 mentions)
Turbo dna free kit, by Thermo Fisher Scientific (4 mentions)
Transcriptor reverse transcriptaze kit, by Roche (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Mastercycler, by Bio-Rad (3 mentions)
Iscript reverse transcription supermix, by Bio-Rad (3 mentions)
Mastercycler, by Eppendorf (3 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Quantitect sybr green, by Qiagen (2 mentions)
Custom primers, by Thermo Fisher Scientific (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Rneasy micro kit, by Qiagen (2 mentions)
Rnaeasy micro kit, by Qiagen (2 mentions)
Fbs phenol free m199 media, by Thermo Fisher Scientific (2 mentions)
Collagenase type 2, by Worthington (2 mentions)
33 protocols using icycler machine
1
Quantifying PROP-Z Levels in Tissues
2
ChIP Protocol using Antibodies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed as described in Fernius et al. (2013) (link) using mouse anti-HA (12CA5, Roche Diagnostics), mouse anti-PK(V5) (AbD Serotec), or rabbit anti-GFP (a kind gift of Dr. Eric Schirmer, University of Edinburgh) antibodies. For experiments in Supplemental Figure S2, A–C, qPCR was performed using a Bio-Rad iCycler machine and the protocol described in Fernius and Marston (2009) (link). For all other experiments shown, qPCR was performed on a Roche LightCycler.
3
Quantitative RT-PCR Analysis of Embryonic Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from whole embryos using TRIzol reagent (Invitrogen). cDNA was synthesized using random primers (Invitrogen) and AMV Reverse Transcriptase (Promega). RT-PCR reactions were performed with primer pairs derived from hec/grip2a and ef1α, using 30 cycles at an annealing temperature of 58°C (in the semi-quantitative range). Absence of genomic contamination was verified by a negative control RT reaction without the Reverse Transcriptase. The following primers were used for the amplifications:
hec/grip2a,5′-GAGACCTGCGGTCAGTCAGAAATC-3′ and 5′-TATGAAGCTCTAGAGGCACTGACG-3′ ,
wnt8a,5′-CGGAAAAATGGGTGGTCGTG-3′ and 5′-AGTCGACCAGCTTCGTTGTT-3′ ,
ef1α,5′-ACCGGCCATCTGATCTACAA-3′ and 5′-CAATGGTGATACCACGCTCA-3′ .
Quantitative (q) RT-PCR was performed on an iCycler machine (Bio-Rad) using iQ SYBR Green Supermix (Bio-Rad). The thermal profile used for amplification is: 95°C for 3 min, 40 cycles of 94°C for 30 s, 58°C for 30 s and 72°C for 30 s. The relative mRNA level was quantified and normalized to ef1α.
hec/grip2a,
wnt8a,
ef1α,
Quantitative (q) RT-PCR was performed on an iCycler machine (Bio-Rad) using iQ SYBR Green Supermix (Bio-Rad). The thermal profile used for amplification is: 95°C for 3 min, 40 cycles of 94°C for 30 s, 58°C for 30 s and 72°C for 30 s. The relative mRNA level was quantified and normalized to ef1α.
4
Quantitative PCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA was isolated and purified from frozen rat tissues using PureLink® Micro-to Midi Total RNA Purification System from Invitrogen (Carlsbad, CA, USA) and following the manufacturer’s protocol. Equal quantities (1.0 µg) of total RNA from each tissue were converted to first-strand cDNA using SuperScript III First-Strand Synthesis SuperMix (Invitrogen, Carlsbad, CA, USA) for RT-PCR. First-strand cDNA was used for qRT-PCR. Primers for qRT-PCR were intron-spanning (Supplemental Table S1 ). Quantitative PCR and melt-curve analyses were performed using iQ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) and an iCycler machine. Relative quantities of expression of the genes of interest in different samples were calculated by the comparative Ct (threshold cycle) value method [39 (link),79 (link),80 (link)].
5
PCR Confirmation of Agrobacterium Transformation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transformation was confirmed by PCR after DNA isolation (Promega Kit, Madison, WI, USA) from all of the clones, from the mother plant as a negative control and from A. rhizogenes A4 bacteria as a positive control. For the PCR reaction, RolC primers (synthetized by Bio Basic Canada Inc. [35 (link)]) and Promega Kit were used. We used a modified PCR program of Soudek et al. [35 (link)]: denaturation 2 min at 94 °C; amplification cycle for 30 times: 0.5 min at 94 °C, 1 min annealing at 59 °C, 1.5 min DNA synthesis at 72 °C; then samples were kept at 4 °C in the Bio-Rad iCycler machine (Hercules, CA, USA). After agarose gel electrophoresis (55 V) rolC genes were detected by UV light at 260 nm. Two technical replicates were run, showing identical results.
6
Quantitative RT-PCR Analysis of FASTKD Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR was carried out using total RNA extracted from cells using TRIzol (Invitrogen). One ug of RNA was treated with DNase1 (Fermentas), and reverse transcribed with random hexamers using a cDNA kit (Applied Biosystems) according to manufacturer's protocol. Specific PCR products were amplified using the FASTKD2 PCR primers [5 (link)] (forward primer, TCCTGAATCCCTAAACATGAAAA; reverse primer, GCCATAACTTCCACGAACTG), a 1:50 dilution of cDNA, and the Maxima SYBR Green/Fluorescein qPCR Master Mix (Fermentas). Forward and reverse primers for qRT-PCR of the other 4 FASTKD mRNAs (FASTKD1,3,4,5,) were as previously described [12 (link)]. SYBR green signals were measured in a BioRad iCycler machine. The values were normalized to an internal 18S ribosomal RNA control.
7
Quantifying Gene Expression in C. elegans
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using TRI Reagent (Sigma), followed by chloroform extraction and isopropanol precipitation. Briefly ~ 300 day 1 adults treated with or without drugs were collected. RNA was DNAase treated using the TURBO DNA-free kit (Applied Biosystems). cDNA was prepared using the First strand cDNA synthesis kit from Invitrogen. qRT-PCR was performed with an iCycler machine (Bio-Rad) using iQ SYBR Green Supermix (Bio-Rad). All reactions were done in triplicate and on at least 2–4 biological replicates. All the values are normalized to ama-1 as internal control as well as to the transcript levels in untreated wildtype.
Primer sequence include
Primer sequence include
8
RNA Isolation and qRT-PCR Analysis in Kocuria-Exposed C. elegans
9
Quantitative Analysis of miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by Trizol reagent (Invitrogen) and RNA concentration was determined by spectrophotometer. 2 μg of RNA was used for reverse transcription with reverse transcription kit (Applied Biosystems) using specific primer sets as supplied with the Taqman assay kits for individual miRNAs. Quantitative real time PCR was performed using cDNA with Taqman real time mix in a BioRad iCycler machine. The fold change in the miRNA levels was determined using RNU6B as an internal control. ΔΔCt method [21 (link)] was used to compare the DCM samples against the normal controls. The 2-ΔΔCT method was used as relative quantification strategy for quantitative real-time polymerase chain reaction (qPCR) data analysis.
10
Quantifying Angiogenic Factors in Muscle Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR was performed to measure mRNA levels of VEGF, PDGF, hypoxia inducible factor (HIF)-1α, fibroblast growth factor (FGF) 2 and endothelial nitric oxide synthase (eNOS). Total RNA was extracted from the adductor muscles with Trizol reagent. mRNA was utilized to synthesize cDNA by superscript II reverse transcriptase. RT-PCR was performed by SYBR Green Real-time PCR Master Mix on an iCycler machine (Bio-Rad, Irvine, CA, USA) to amplify cDNA according to the manufacturer’s instructions. The expression of gene mRNA was normalized with the housekeeping gene β-actin. Relative changes in gene expression were analyzed using the 2−ΔΔCt method (Livak & Schmittgen, 2001 (link)). Sequence primers for PCR:
VEGF (F: 5′-CACAGCAGATGTGAATGCAG-3′, R: 5′-TTTACACGTCTGCGGATCTT-3′)
PDGF (F: 5′-CTCTTGGAGATAGACTCCGTAGG-3′, R: 5′-ACTTCTCTTCCTGCGAATGG-3′)
HIF-1α (F: 5′-GGGTACAAGAAACCACCCAT-3′, R: 5′-GAGGCTGTGTCGACTGAGAA-3′)
FGF2 (F: 5′-CAACCGGTACCTTGCTATGA-3′, R: 5′-TCCGTGACCGGTAAGTATTG-3′)
eNOS (F: 5′- CCTTCCGCTACCAGCCAGA-3′, R: 5′-CAGAGATCTTCACTGCATTGGCTA-3′)
ACTB (F: 5′-AGTGTGACGTTGACATCCGT-3′, R: TGCTAGGAGCCAGAGCAGTA-3′).
VEGF (F: 5′-CACAGCAGATGTGAATGCAG-3′, R: 5′-TTTACACGTCTGCGGATCTT-3′)
PDGF (F: 5′-CTCTTGGAGATAGACTCCGTAGG-3′, R: 5′-ACTTCTCTTCCTGCGAATGG-3′)
HIF-1α (F: 5′-GGGTACAAGAAACCACCCAT-3′, R: 5′-GAGGCTGTGTCGACTGAGAA-3′)
FGF2 (F: 5′-CAACCGGTACCTTGCTATGA-3′, R: 5′-TCCGTGACCGGTAAGTATTG-3′)
eNOS (F: 5′- CCTTCCGCTACCAGCCAGA-3′, R: 5′-CAGAGATCTTCACTGCATTGGCTA-3′)
ACTB (F: 5′-AGTGTGACGTTGACATCCGT-3′, R: TGCTAGGAGCCAGAGCAGTA-3′).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!