Nextera xt dual indices

The following procedure was done according to Tallei et al. [16 (link)]. An Illumina two-step PCR protocol was used for preparing the amplicons library. The first stage was to generate PCR products of V3-V4 regions using Nextera-style tag sequences (overhang sequences) with the following sequences: forward overhang P5-tag: 5′TCGTCGGCAGCGTCAGATGTGTAT AAGAGACAG-[locus-specific sequence] and reverse overhang P7-tag: 5′GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[locus-specific sequence]. The second stage used sample-specific Illumina Nextera XT dual indices (Nextera XT i7 index and Nextera XT i5 index) with the following sequences: P5-PCR index primer: 5′AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC and P7-PCR index primer:5′CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGC TCGG. The final products were assessed using TapeStation 4200 from Agilent Technologies, HelixyteTM green dsDNA quantifying reagent, and qPCR using Jetseq library quantification Lo-Rox kit from Bioline (London, UK). The paired-end sequences were generated in a 2 × 300 bp format from MiSeq.

DNA extraction and 16S ribosomal RNA gene amplification were conducted as previously described [23 (link)]. In brief, the soil cores were thawed and manually homogenized. Genomic DNA was extracted from 250 mg of each sample using DNeasy PowerSoil HTP kits (Qiagen, Valencia, CA, USA). For the analysis of bacterial community taxonomy, data previously generated were used [24 (link), 23 (link)]. The V3-V4 region of 16S rRNA genes was amplified through PCR. Purified PCR products were submitted to New Zealand Genomics Ltd. (Auckland, New Zealand), barcoded (Nextera XT dual indices), pooled and sequenced on an Illumina MiSeq instrument, producing 2 × 300 bp paired-end reads.
New data were generated to analyse the functional potential of the microbial communities at each site. Shotgun metagenomic sequencing was undertaken by Otago Genomics Ltd., New Zealand, to analyse the functional potential of each of the sites. Equal amounts of extracted DNA from each of the site replicates were pooled to produce a composite sample for each site. Sequencing was conducted on an Illumina HiSeq 2500 Instrument, producing sequence lengths of 2 × 150 bp.