Log In Sign up
The largest database of trusted experimental protocols

Dig easy hyb solution

Manufactured by Roche
Visit Supplier
Sourced in United States, Germany

DIG Easy Hyb solution is a nucleic acid hybridization buffer designed for use in DNA and RNA detection assays. It is optimized for high-specificity hybridization of labeled probes to target sequences.

Automatically generated - may contain errors

Lab products found in correlation

Hybond, by Cytiva (12 mentions) Pcr dig probe synthesis kit, by Roche (6 mentions) Dig probe synthesis kit, by Roche (4 mentions) Positively charged nylon membrane, by Roche (4 mentions) Cdp star, by Roche (3 mentions) Positive charged nylon membrane, by Roche (3 mentions) Cdp star chemilumnescent substrate, by Merck Group (3 mentions) X ray film, by Genesee Scientific (3 mentions) Hybond n membrane, by Cytiva (3 mentions) Dig wash and block buffer set, by Roche (3 mentions) Hybond n membrane, by Pall Corporation (2 mentions) Pcr dig labeling mix, by Roche (2 mentions) Nylon membrane, by Roche (2 mentions) Dig northern starter kit, by Roche (2 mentions) Hybond nylon membrane, by Cytiva (2 mentions) Hybond n, by Cytiva (2 mentions) Chemidoc imaging system, by Bio-Rad (2 mentions) Alkaline phosphatase labeled anti digoxigenin antibody, by Roche (2 mentions) Cdp star ready to use, by Roche (2 mentions) Hybond n membrane, by GE Healthcare (2 mentions)

Spelling variants of this product

DIG Easy Hyb (59 citations) DIG Easy Hyb hybridization solution (2 citations)

34 protocols using dig easy hyb solution

1

Detecting GCRV Infection in CIK Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
CIK cells were grown in 6-well plates and infected with GCRV at an MOI of 1. Then the cells were transfected with dsRNA-S10 with or without pEGFP-TIA1. At 48 h post transfection, cells were harvested and the RNA was extracted with Trizol. The RNA was separated on a 1.5% agarose formaldehyde denaturing gel and transferred to a nitrocellulose membrane using the upward capillary method. The membrane was pre-hybridized for 30 min using the Dig Easy Hyb Solution (Roche), and then hybridized for 6 h in Dig Easy Hyb Solution containing the synthesized digoxin-labeled dsRNA-S10 probe using Dig RNA Labeling Kit-T7 (Roche). The membrane was washed at room temperature in Wash Buffer I (2× SSC, 0.1% SDS) and Wash Buffer II (0.1× SSC, 0.1% SDS) using each buffer twice for 15 min. After hybridization and stringent washing, the membrane was rinsed briefly for 5 min in Wash Buffer III (0.1 M Maleic acid; 0.15 M NaCl; PH 7.5; 0.3% Tween 20), and incubated for 30 min in Blocking solution (Roche). Then secondary antibody, anti-digoxingenin-AP, was diluted 1:10,000 in Blocking buffer and incubated with the membrane for 30 min. The membrane was then washed twice in Wash Buffer III and equilibrated for 5 min in Detection buffer (Roche). The signal was detected using NBT/BCIP (Roche).
Song L., Wang H., Wang T, & Lu L. (2015). Sequestration of RNA by grass carp Ctenopharyngodon idella TIA1 is associated with its positive role in facilitating grass carp reovirus infection. Fish & Shellfish Immunology, 46(2), 442-448.
+ Open protocol
+ Expand
2

Quantification of siRNA Expression in Transgenic Cotton

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total small RNA population was isolated from the leaves of transgenic and NT control plants43 (link). It was performed to assess the expression level of siRNA in transgenic (T0, T1) plants with respect to corresponding non-transformed cotton plants. The low molecular weight RNA were separated on denaturing polyacrylamide gel (PAGE 15%) and transferred onto a Hybond-N nylon membrane (GE Healthcare, UK). Hybridization was performed with CLCuMuV-C4 gene-based DIG-11-dUTP labelled probe at 42 °C in DIG Easy Hyb solution using DIG DNA labelling and detection kit (Roche Diagnostics, Germany). The membrane was equilibrated in Detection buffer containing NBT/BCIP-T under Gel Doc™ EZ System (BioRad, USA) using the Image Lab™ software Version 4.1. siRNA fragments (20–25 nt long) were visualized, which were compared with the original PAGE exhibiting ultra-low range RNA marker (Thermo Scientific, Germany).
Baig M.S., Akhtar S, & Khan J.A. (2021). Engineering tolerance to CLCuD in transgenic Gossypium hirsutum cv. HS6 expressing Cotton leaf curl Multan virus-C4 intron hairpin. Scientific Reports, 11, 14172.
+ Open protocol
+ Expand
3

RNA Expression Analysis by Northern Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols
The 254-bp probe was in vitro transcribed using DIG Labeling Kit (MyLab Corporation, Beijing, China) and T7 RNA polymerase, and treated with RNase-free DNase I. For Northern blot, 20 μg of total RNA was separated on 3-(N-morpholino)propanesulfonic acid (MOPS)-buffered 2% (w/v) agarose gel containing 1.2% (v/v) formaldehyde under denaturing conditions for 4 h at 80 V, and transferred to Hybond-N+ membrane (Pall Corp., Port Washington, NY). Prehybridization was carried out at 65 °C for 30 min in DIG Easy Hyb solution (Roche, Indianapolis, IN). Hybridization was performed at 65 °C for 16–18 h. Blots were washed stringently, detected by anti-digoxigenin (DIG) antibody, and recorded on X-ray films with chemiluminescence substrate CSPD (Roche).
Song H., Li D., Wang X., Fang E., Yang F., Hu A., Wang J., Guo Y., Liu Y., Li H., Chen Y., Huang K., Zheng L, & Tong Q. (2020). RETRACTED ARTICLE: HNF4A-AS1/hnRNPU/CTCF axis as a therapeutic target for aerobic glycolysis and neuroblastoma progression. Journal of Hematology & Oncology, 13, 24.
+ Open protocol
+ Expand
4

Southern Blot Detection of Repetitive DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was digested with restriction endonucleases, fractionated on 2% agarose gel, and transferred onto nylon membranes (Roche Diagnostics). DNA fragments of repetitive sequences were labeled with DIG-11-dUTP using PCR DIG Labeling Mix (Roche Diagnostics) and hybridized to the membrane. Hybridization was performed overnight at 45°C in DIG Easy Hyb Solution (Roche Diagnostics). After hybridization, the membrane was washed at 45°C in 0.1% sodium dodecyl sulfate (SDS)/2× saline sodium citrate (SSC), 0.1% SDS/1× SSC, 0.1% SDS/0.5× SSC, and 0.1% SDS/0.1× SSC for 15 min each. Chemiluminescent signals were detected with anti-DIG-AP Fab fragments and CDP-Star (Roche Diagnostics) and exposed to Biomax MS-1 Autoradiography Film (Carestream Health, Rochester, NY, USA).
Uno Y., Nishida C., Hata A., Ishishita S, & Matsuda Y. (2019). Molecular cytogenetic characterization of repetitive sequences comprising centromeric heterochromatin in three Anseriformes species. PLoS ONE, 14(3), e0214028.
+ Open protocol
+ Expand
5

Southern Blot Genotyping Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Southern blot hybridization was performed using DIG High Prime DNA Labeling and Detection Kit 2 (Roche Molecular Systems, Pleasanton, CA, USA). Ten micrograms of genomic DNA were digested with a Bst EII (Takara, Shiga, Japan) overnight at 60°C. As represented in Figure 1, the digestion generates a 6.8 kb fragment in the wild allele and an 8.1 kb fragment in the targeted allele. Samples were separated on a 0.8% agarose gel. Following electrophoresis, restricted genomic DNA was transferred to a nylon membrane (Roche, Switzerland). Then, the membrane was hybridized with a 520 bp DIG-labeled probe in DIG Easy Hyb solution (Roche Molecular Systems, USA) for 16 h at 53°C. After the hybridization, membrane was washed twice in 0.5× SSC with 0.1% sodium dodecyl sulfate at 68°C and exposed to a camera for 10 min.
Kim Y.J., Ahn K.S., Kim M., Kim M.J., Ahn J.S., Ryu J., Heo S.Y., Park S.M., Kang J.H., Choi Y.J, & Shim H. (2016). Alpha-1,3-galactosyltransferase-deficient miniature pigs produced by serial cloning using neonatal skin fibroblasts with loss of heterozygosity. Asian-Australasian Journal of Animal Sciences, 30(3), 439-445.
+ Open protocol
+ Expand
6

Southern Blot Analysis of B. pertussis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chromosomal DNA was extracted and purified from BPSM and ΔkpsT and ΔkpsE bacteria using Genomic-tip 100/G Anion-Exchange Resin (Qiagen) and Genomic DNA Buffer Set (Qiagen) according to the manufacturer's instructions. 1 µg of chromosomal DNA from B. pertussis strains were digested with restriction enzymes for 4 hrs and subjected to 0.8% agarose gel electrophoresis. The agarose gel containing the digested DNA was chemically treated and transferred onto a nitrocellulose membrane (Milipore) according to Roche's DIG application manual. The membrane was UV-fixed for 1 min and equilibrated with 10 ml pre-heated DIG Easy Hyb solution (Roche) at 65°C for 20 min, with gentle agitation. A digoxigenin (DIG)-labelled probe was amplified using the PCR DIG Probe Synthesis Kit (Roche) according to the manufacturer's instructions. For hybridization, about 5-25 ng/ml of heat-denatured DIG-labeled DNA probe in DIG Easy Hyb solution was incubated with the membrane overnight at 65°C. Detection was performed using alkaline phosphatase-conjugated anti-DIG antibody (Roche) at a dilution of 1∶5,000. The membrane was developed using NBT/BCIP AP substrate (Chemicon).
Hoo R., Lam J.H., Huot L., Pant A., Li R., Hot D, & Alonso S. (2014). Evidence for a Role of the Polysaccharide Capsule Transport Proteins in Pertussis Pathogenesis. PLoS ONE, 9(12), e115243.
+ Open protocol
+ Expand
7

Quantitative Southern Blot Analysis of Genomic DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
A 241-bp digoxigenin (DIG)-labeled probe was generated from 100 ng control genomic DNA (gDNA) by PCR reaction using Q5 High-Fidelity DNA Polymerase (NEB) with primers shown in Table S2. Genomic DNA was harvested from control and patient iPSCs using cell lysis buffer (100 mM Tris-HCl pH 8.0, 50 mM EDTA, 1% w/v sodium dodecyl sulfate (SDS)) at 55°C overnight and performing phenol:chloroform extraction. A total of 25 μg of gDNA was digested with AflII at 37°C overnight, run on a 0.8% agarose gel, then transferred to a positive charged nylon membrane (Roche) using suction by vacuum and UV-crosslinked at 120 mJ. The membrane was pre-hybridized in 25 mL DIG EasyHyb solution (Roche) for 3 h at 47°C then hybridized at 47°C overnight in a shaking incubator, followed by two 5-min washes each in 2X Standard Sodium Citrate (SSC) and in 0.1% SDS at room temperature, and two 15-min washes in 0.1x SSC and in 0.1% SDS at 68°C. Detection of the hybridized probe DNA was carried out as described in DIG System User’s Guide. CDP-Star Chemilumnescent Substrate (Sigma-Aldrich) was used for detection and the signal was developed on X-ray film (Genesee Scientific) after 20 to 40 min.
Hendricks E., Quihuis A.M., Hung S.T., Chang J., Dorjsuren N., Der B., Staats K.A., Shi Y., Maria N.S., Jacobs R.E, & Ichida J.K. (2023). The C9ORF72 repeat expansion alters neurodevelopment. Cell reports, 42(8), 112983.
+ Open protocol
+ Expand
8

Northern Blot Analysis of circ‐CUX1

Check if the same lab product or an alternative is used in the 5 most similar protocols
The non‐junction and junction probes specific for circ‐CUX1 were synthesized and labeled by digoxigenin (DIG, Appendix Table S2). For Northern blot, 20 μg of total RNA was separated on 3‐(N‐morpholino)propanesulfonic acid‐buffered 2% (w/v) agarose gel containing 1.2% (v/v) formaldehyde under denaturing condition at 80 V for 4 h, and transferred to Hybond‐N+ membrane (Pall Corp., Port Washington, NY). Hybridization was performed at 65°C for 16–18 h in DIG Easy Hyb solution (Roche) and detected by anti‐DIG antibody (1:500 dilution) and chemiluminescence substrate CSPD (Roche).
Li H., Yang F., Hu A., Wang X., Fang E., Chen Y., Li D., Song H., Wang J., Guo Y., Liu Y., Li H., Huang K., Zheng L, & Tong Q. (2019). Therapeutic targeting of circ‐CUX1/EWSR1/MAZ axis inhibits glycolysis and neuroblastoma progression. EMBO Molecular Medicine, 11(12), e10835.
+ Open protocol
+ Expand
9

Northern Blot Analysis of HSFAS Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
Northern blot was conducted using a DIG Northern Starter kit (Roche, Basel, Switzerland) by Sangon Biotech (Shanghai) Co. Ltd (Shanghai, China). Briefly, DIG-labelled probes were synthesized using a PCR DIG Probe Synthesis kit (Roche), and the primer sequences for probe preparation are listed in
Table 2.

Table 2 Primer sequences for Northern blot analysis

Gene

Forward primer (5′→3′)

Reverse primer (5′→3′)

HSFAS

CTAGGCGAAAGAAATCGAAGTG

GCTAAGTTTGCCGAGTAAATCC

Total RNA (15 μg) was loaded onto 1% formaldehyde denatured gel electrophoresis, transferred to a Hybond nylon membrane (Amersham Biosciences, Buckinghamshire, UK), and fixed at 80°C for 2 h. The membrane was prehybridized in DIG Easy Hyb solution (Roche) at 50°C for 2 h and then hybridized with DIG-labelled probes at 50°C overnight. After being washed with 2× SSC at room temperature for 5 min and then with 0.1× SSC at 68°C for 15 min, the membrane was blocked in blocking solution for 1 h, incubated with antibody solution for 30 min, and detected using X-ray films.
Ma F., Liu H., Xia T., Zhang Z., Ma S., Hao Y., Shen J., Jiang Y, & Li N. (2023). HSFAS mediates fibroblast proliferation, migration, trans-differentiation and apoptosis in hypertrophic scars via interacting with ADAMTS8: HSFAS regulates hypertrophic scars via inhibiting ADAMTS8. Acta Biochimica et Biophysica Sinica, 56(3), 440-451.
+ Open protocol
+ Expand
10

Profiling Small RNA Species in Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from mouse tissues and cell lines using TRIzol reagents, per the manufacturer’s instructions. RNA was separated by 10% urea-PAGE gel stained with SYBR Gold, and immediately imaged, then transferred to positively charged nylon membranes (Roche; 11417240001) and ultraviolet crosslinked with an energy of 0.12 J. Membranes were pre-hybridized with DIG Easy Hyb solution (Roche; 11603558001) for 1 h at 42 °C. To detect miRNAs, tsRNAs and rsRNAs in the total RNA and 15- to 50-nucleotide small RNAs, membranes were incubated overnight (12–16 h) at 42 °C with DIG-labelled oligonucleotide probes synthesized by Integrated DNA Technologies as follows: rsRNA-28s-1 (5′-DIG-ATTCAGCGGGTCGCCACGTCT); rsRNA-28s-2 (5′-DIG-GGTCCGCACCAGTTCT); rsRNA-28s-3 (5′-DIG-CGCCAGGTTCCACACGAACGT); rsRNA-18s-1 (5′-DIG-AGGCACACGCTGAGCCAGTCAGT); 5′ tsRNAGlu (5′-DIG-AACCACTAGACCACCAGGGA); 5′ tsRNAAla (5′-DIG-GCACGCGCTCTACCACTG); 5′ tsRNAHis (5′-DIG-AGTACTAACCACTATACGATCACGG); 3′ tsRNAArg (5′-DIG-TGGCGAGCCAGCCAGGAGTCGA); 3′ tsRNALys (5′-DIG-TGGCGCCCGAACAGGGACTT); let-7i (5′-DIG-CAGCACAAACTACTACCTCA); let-7f (5′-DIG-AACTATACAATCTACTACCTCA); miR-122 (5′-DIG-AAACACCATTGTCACACTCCA); miR-21 (5′-DIG-TCAACATCAGTCTGATAAGCTA); 3′ adapter probe (5′-DIG-AGACGTGTGCTCTTCCGATCT).
Shi J., Zhang Y., Tan D., Zhang X., Yan M., Zhang Y., Franklin R., Shahbazi M., Mackinlay K., Liu S., Kuhle B., James E.R., Zhang L., Qu Y., Zhai Q., Zhao W., Zhao L., Zhou C., Gu W., Murn J., Guo J., Carrell D.T., Wang Y., Chen X., Cairns B.R., Yang X.L., Schimmel P., Zernicka-Goetz M., Cheloufi S., Zhang Y., Zhou T, & Chen Q. (2021). PANDORA-seq expands the repertoire of regulatory small RNAs by overcoming RNA modifications. Nature cell biology, 23(4), 424-436.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!