Instagenetm matrix

DNA was extracted using the InstaGene^TM Matrix according to the manufacturer’s instructions (Bio-Rad, Milan, Italy). The D1/D2 domains of the 26S rRNA gene was amplified for the yeast identification using the NL1 (5′ GCATATCAATAAGCGGAGGAAAAG 3′) and NL4 (5′ GGTCCGTGTTTCAAGACGG 3′) primer pair [23 (link)]. The PCR products were purified by ExoSAP-IT (Thermo Fisher, Milan, Italy) according to the manufacturer’s instructions and delivered to BMR Genomics (Padua University, Padua, Italy) for sequencing. The obtained sequences were compared to those available in the GenBank database (http://www.ncbi.nml.nih.gov/BLAST, accessed on 3 January 2024) in order to determine the closest known relative species on the basis of the 26S rRNA gene homology.
The strains were typed by RAPD-PCR with the primer M13 (5′ GAGGGTGGCGGTTCT 3′), as previously described [24 (link)]. The Fingerprinting II Informatix^TM software program (Bio-Rad, Milan, Italy) was employed for the conversion and normalization of the RAPD-PCR patterns. The similarities among the profiles were calculated by clustering the Pearson’s r correlation matrix using the unweighted pair group method with average (UPGMA) algorithm.

Fecal samples (n = 446) were individually enriched as previously described by Stromberg et al. (2015). Briefly, 1 g of fecal material was homogenized with 9 mL EC broth (BD Difco, Franklin Lakes, NJ, USA) and incubated at 37 °C for 18 h [21 (link)]. Then three loops of the enriched material were inoculated on McConkey agar (BD Difco) plates and incubated at 37 °C for 24 h. Bacterial DNA was extracted from the confluent growth area with the InstaGene^TM Matrix (Bio-Rad, Hercules, CA, USA) following manufacturer’s instructions. We ran a multiplex PCR screen to detect the stx₁ and stx₂ genes, using previously described conditions and primers [22 (link)] (Table 1). PCR reactions were performed using GoTaq^® Green Master Mix, following manufacturer’s instructions (Promega, Madison, WI, USA).
For each sample testing positive for stx₁ and/or stx₂, we re-isolated 30 colonies from the original McConkey plate where the bacterial DNA was previously extracted. These colonies were examined for the presence of stx genes by PCR, and stx positive isolates were later confirmed as E. coli by a PCR described by Chen et al. [24 (link)] (Table 1). We selected 1 to 4 STEC colonies from each positive sample and stored them in 20% glycerol at −80 °C until further analysis.

Phylogenetic analyses of growth-positive cultures were based on PCR amplification and sequencing of 16S rRNA genes. DNA templates for PCR were prepared from growth-positive cultures using the InstaGene^TM Matrix (Bio-Rad) according to the manufacturer’s instructions. The amplification of 16S rRNA genes were performed by PCR using 27F and 1492R primers, followed by Sanger sequencing with 800R and 518F primers (Macrogen Inc., Korea). Taxonomic classification of 610 strains obtained from the HTC experiments was carried out using the “classify.seqs” command of the Mothur software package (v1.39.5)^{63 (link)} using the SILVA database SSURef NR99 (release 132)^{64 (link)} as a reference. For more refined taxonomic and phylogenetic analysis of the SAR202 isolates, the 16S rRNA gene sequences were aligned using the SINA online aligner (v1.2.11, http://www.arb-silva.de/aligner)^{65 (link)}, imported into ARB program^{66 (link)}, and inserted using the ARB parsimony into the guide tree of SILVA database SSURef NR99 (release 132)^{64 (link)}. After manual curation, the aligned sequences of the isolates and their phylogenetic relatives were exported with “ssuref:bacteria” filter. Maximum-likelihood phylogenetic trees were constructed using RAxML^{67 (link)} (v8.2.12) with GTRGAMMA method including 100 bootstrap replicates and visualized using the MEGA software (v7.0)^{68 (link)}.

Molecular identification was done by 16S rRNA analysis. Briefly, high yield of chitinase producer Bacillus licheniformis (SSCL-10) reported in our earlier studies [7 ] was selected for the study. Bacterial genomic DNA of Bacillus licheniformis (SSCL-10) was extracted using the Insta Gene TM Matrix (Bio-Rad, cat-no. 7326030), according to the manufacturers' instruction. Then, a 16S rRNA subunit gene fragment was amplified by using 16S rRNA universal primers 27F (5′-AGAGTTTGATCMTGG CTCAG-3′) and the reverse primer 1492R (5′-TACGGYTACCTTGTTACGACTT-3′) [22 (link)] using MJ Research Peltier Thermal Cycler (Marshall Scientific, USA). PCR was performed in a 30 μL reaction mixture (20 ng genomic DNA) under the following cycling conditions: 95°C for 2 min, followed by 35 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for 1 min, with a final incubation at 72°C for 10 min.