Mir 21

Manufactured by Thermo Fisher Scientific

Sourced in United States

MiR-21 is a microRNA detection kit designed for use in molecular biology research. The kit provides reagents and protocols for the quantitative detection of miR-21, a microRNA that is commonly measured in various research applications. The core function of the MiR-21 kit is to enable researchers to accurately quantify the expression levels of miR-21 in their samples.

Automatically generated - may contain errors

Lab products found in correlation

11 protocols using mir 21

Quantification of miR-21 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was quantified using an Infinite 200 Pro (Tecan). The cDNA pre-amplification reaction utilized 40 ng of RNA with an RT primer pool including RNU48 and miR-21 (Thermo Scientific) as well as a “spike-in control” of cel-miR-39 to 5 nM. The cDNA reaction was carried out according to the TaqMan MicroRNA Assay Protocol (Thermo Scientific). cDNA was diluted 1:100 and qRT-PCR was performed with TaqMan primer probes against RNU48, miR-21, and cel-miR-39 on a StepOnePlus Real-Time PCR System (Thermo Scientific). Average C_T values were determined for each sample based on a combination of all replicates for that sample and miRNA probe. The delta-delta C_T method was used to normalize miR-21 results to the spiked in control, cel-miR-39 (e.g.

{\bar{C_{T}}}_{cel - miR - 39} - {\bar{C_{T}}}_{miR 21}

Crawford B.M., Wang H.N., Stolarchuk C., von Furstenberg R.J., Strobbia P., Zhang D., Qin X., Owzar K., Garman K.S, & Vo-Dinh T. (2020). Plasmonic Nanobiosensors for Detection of MicroRNA Cancer Biomarkers in Clinical Samples. The Analyst, 145(13), 4587-4594.

+ Open protocol

+ Expand

Urine Exosomal miRNA Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated by Trizol, as previously described [4 (link)]. The miRNA expression was determined by RT-PCR, according to the manufacturer's instructions and as previously described [4 (link)]. We selected miR-21, miR-204 and miR-375 (Life Technologies, Grand Island, MY, USA; miR-21 #000397, miR-204 #000508 and miR-375 #000564), which were described to be present in the urine EVs.

Wachalska M., Koppers-Lalic D., van Eijndhoven M., Pegtel M., Geldof A.A., Lipinska A.D., van Moorselaar R.J, & Bijnsdorp I.V. (2016). Protein Complexes in Urine Interfere with Extracellular Vesicle Biomarker Studies. Journal of Circulating Biomarkers, 5, 4.

+ Open protocol

+ Expand

Quantifying miRNA and mRNA Profiles

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells and exosomes using the miRNeasy Micro kit according to the manufacturer's instructions (Qiagen Inc., Valencia, CA). RNA concentration was measured using the NanoDrop ND-100 Spectrophotometer (NanoDrop Technologies, Wilmington, DE). For miRNA expression analysis, 50 ng of RNA was mixed with TaqMan MicroRNA Reverse Transcription Kit reagent containing specific miRNA primers and reverse transcribed according to the manufacturer's instructions (Thermo Scientific, Rockford, IL). Real-time PCR was performed by diluting the complementary cDNA product in 2× TaqMan Universal Master Mix II and 20× TaqMan microRNA Expression Assay for each mature miRNA to be measured: miR-1305 and miR-21 (Applied Biosystems, Waltham, MA). U6 and cel-miR-39 were used as the normalization controls for cells and extracellular vesicles, respectively, in miRNA expression-level analysis. For quantification of gene expression, 2 μg RNA was converted to cDNA using an Omniscript RT kit (Qiagen, Valencia, CA). The cDNA generated was amplified using TaqMan assay for HIF-1α, Nanog, OCT4, SOX2 and β-actin. Reactions were carried out in a QuantStudio 6 system (Applied Biosystems) and the results expressed as fold change calculated with the comparative CT (ΔΔCt) method relative to the control sample. β-Actin was used as the internal control for mRNA analysis.

Lee J.Y., Ryu D., Lim S.W., Ryu K.J., Choi M.E., Yoon S.E., Kim K., Park C, & Kim S.J. (2021). Exosomal miR-1305 in the oncogenic activity of hypoxic multiple myeloma cells: a biomarker for predicting prognosis. Journal of Cancer, 12(10), 2825-2834.

+ Open protocol

+ Expand

Placental miRNA Expression Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Trizol (Invitrogen, CA, USA) method was used to extract mRNA from the human placental tissue. Reverse transcription was performed using 1 mg of the total RNA (TakaRa Biotechnology, Dalian, China) to generate total cDNA. TaqMan MicroRNA Reverse Transcription Kit, miR-21, and U6 probes (Applied Biosystems, CA, USA) of Universal PCR Master Mix (Applied Biosystems, CA, USA) were used for reverse transcription and quantitative PCR of miRNA. Fifteen random pair samples from each age group (OGTT: 1st h; 2nd h; 0 h and 1st h; 0 h and 2nd h; 1st h and 2nd h; 0 h, 1st h, and 2nd h) and 18 random pair samples from each age group (≤25 Y, 26–30 Y, 31–35 Y, and ≥36 Y) were selected for qRT-PCR. Each sample in each experiment was detected in triplicates.

Guan C.Y., Tian S., Cao J.L., Wang X.Q., Ma X, & Xia H.F. (2020). Down-Regulated miR-21 in Gestational Diabetes Mellitus Placenta Induces PPAR-α to Inhibit Cell Proliferation and Infiltration. Diabetes, Metabolic Syndrome and Obesity: Targets and Therapy, 13, 3009-3034.

+ Open protocol

+ Expand

Inhibiting miR-21 with Hairpin and Decoy

Check if the same lab product or an alternative is used in the 5 most similar protocols

MiRNA hairpin inhibitor-miR-21 was purchased from Thermo Scientific (miRIDIAN microRNA hairpin inhibitors, IH-300492-05). Anti-miR-21-5p tough decoy RNA was purchased from Sigma-Aldrich (MISSION Synthetic microRNA Inhibitor).

Mie Y., Hirano Y., Kowata K., Nakamura A., Yasunaga M., Nakajima Y, & Komatsu Y. (2017). Function Control of Anti-microRNA Oligonucleotides Using Interstrand Cross-Linked Duplexes. Molecular Therapy. Nucleic Acids, 10, 64-74.

+ Open protocol

+ Expand

Quantitative miRNA Expression Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Taqman miRNA assay for miR-10b, miR-16, and miR-21 were purchased from ThermoFisher Scientifics.

Akers J.C., Hua W., Li H., Ramakrishnan V., Yang Z., Quan K., Zhu W., Li J., Figueroa J., Hirshman B.R., Miller B., Piccioni D., Ringel F., Komotar R., Messer K., Galasko D.R., Hochberg F., Mao Y., Carter B.S, & Chen C.C. (2017). A cerebrospinal fluid microRNA signature as biomarker for glioblastoma. Oncotarget, 8(40), 68769-68779.

+ Open protocol

+ Expand

Cell line culture and DNA/RNA extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

For cell-free DNA (cfDNA) and genomic DNA (gDNA), A549, lung cancer cell line, was purchased from the American Type Culture Collection (Rockville, MD, USA) and maintained in RPMI-1640 medium (Wako Pure Chemical Industries, Osaka, Japan) supplemented with 5% fetal bovine serum (Thermo Fisher Scientific Inc., Waltham, MA, USA) and antibiotic-antimycotic reagent (Wako Pure Chemical Industries, Osaka, Japan) at 37 °C in a humidified incubator with 5% CO₂. Genomic DNA (gDNA) from the cell lines was extracted using a standard phenol-chloroform method. gDNA were fragmented to an average size of 200 and 2000 bp, using Covaris S220 manufactured by Covaris (Woburn, MA, USA) and used as cfDNA and gDNA, respectively. mRNA (150 bp) from the cell lines was extracted using TRIzol reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA) following the manufacturer’s protocol. For miRNA, 3 different kinds of miRNA (-21, -155, -124) were purchased from the manufacturer (Thermo Fisher Scientific Inc., Waltham, MA, USA) (miR-21, UAGCUUAUCAGACUGAUGUUGA; miR-155, UUAAUGCUAAUCGUGAUAGGGGUU; miR-124, CGUGUUCACAGCGGACCUUGAU).

Takahashi H., Yasui T., Klamchuen A., Khemasiri N., Wuthikhun T., Paisrisarn P., Shinjo K., Kitano Y., Aoki K., Natsume A., Rahong S, & Baba Y. (2021). Annealed ZnO/Al2O3 Core-Shell Nanowire as a Platform to Capture RNA in Blood Plasma. Nanomaterials, 11(7), 1768.

+ Open protocol

+ Expand

Investigating DUSP1, miR-21, JAK2, STAT3 Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

CSCC line C33a was purchased from ATCC Cell Bank, USA. DUSP1, miR-21, JAK2, and STAT3 mRNA primers were purchased from Thermo Fisher Scientific, USA. DUSP1, miR-21, JAK2, STAT3 mRNA primers and β-actin primers (Sigma, USA). DUSP1, miR21, JAK2, STAT3 mRNA primers and β-actin primers (Sigma, USA); qPCR assay kit, immunohistochemistry sheep anti-rabbit secondary antibody, CCK-8 assay kit (Shanghai Biyuntian Co. (Shanghai Biyuntian); Transwell (Corning, USA); artificially reconstituted basement membrane gel (Matrigel) (Abcam Biotechnology Ltd., UK); DUSP1, JAK2 and STAT3 primary antibodies (BD, USA). Ltd.); cellular DUSP1 gene overexpression lentivirus (Shanghai Gikai Genetics Co., Ltd.) for this study.

Chen H., Ren S., Wan H., Wei W., Luo Y, & Cai M. (2023). DUSP1 regulates the JAK2/STAT3 signaling pathway through targeting miR-21 in cervical cancer cells. Cellular and molecular biology (Noisy-le-Grand, France), 69(8).

+ Open protocol

+ Expand

Quantitative RT-PCR of Candidate miRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The candidate miRNAs were reverse-transcribed and amplified using specific primers for miR-21 (assay ID 000397), miR-10b (assay ID 002218), let-7a (assay-ID 000377), and cel -39 (assay-ID 000200) from Thermo Fisher Scientific. During reverse transcription, a total of 10 ng RNA was used to convert miRNA to cDNA using TaqMan reverse transcription kit (Applied Biosystems, Thermo Fisher Scientific). The qPCR was conducted with an Applied Biosystem® 7500 Real-Time PCR System.

Tangtanatakul P., Klinchanhom S., Sodsai P., Sutichet T., Promjeen C., Avihingsanon Y, & Hirankarn N. (2019). Down-regulation of let-7a and miR-21 in urine exosomes from lupus nephritis patients during disease flare. Asian Pacific journal of allergy and immunology, 37(4).

+ Open protocol

+ Expand

Quantifying miRNA Expression in Immune Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from sorted bone marrow derived macrophages, lung AM and brain microglia of WT or Csf1r^CreDicer^fl/fl knockout mice with miRNeasy Mini Kit (QIAGEN). The RNA was reverse-transcribed to cDNA with miRCURY LNA^TM microRNA RT Kit (Exiqon). Quantitative real-time PCR reactions were prepared using FastStart Universal SYBR Green Master (ROX, Roche) and carried out in QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). The U6 primer set was purchased from Exiqon (Product No.: 203907). All other miRNA primer sets were purchased from Life Technologies, including miR-17 (Assay ID: 002308), miR-18a (Assay ID: 002422), miR-19a (Assay ID: 000395), miR-19b (Assay ID: 000396), miR-20a (Assay ID: 000580), miR-92a (Assay ID: 000430), miR-21 (Assay ID: 000397), miR-146a (Assay ID: 000468), miR-150 (Assay ID: 000473), miR-155 (Assay ID: 002571) and miR-233 (Assay ID: 002295). Relative miRNA expressions were normalized to U6 expression.

Yao Y., Martin C., Yin C., Guo C., Dong Z., Zhou L, & Mi Q.S. (2018). miRNAs are required for Langerhans cell, skin and lung resident macrophage ontogeny. The Journal of allergy and clinical immunology, 142(3), 976-978.e2.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!