Pcdh cmv mcs puro expression vector

To knockdown ZFP36, three short hairpin RNA (shRNA) constructs targeting ZFP36 (ZFP36-shRNA1#, 5′-CGACATAGCTCAGTCTTGTAG-3′; shRNA2#, 5′-AAACAGAGATGCGATTGAAGA-3′; shRNA3#, 5′-GTCAGATCCATGGTGTAACGG−3′); To knockdown PRC1, three shRNAs constructs targeting PRC1 (PRC1-shRNA1#, 5′-TTCAGTTGTCTTTCCTGCTTG-3′; PRC1-shRNA2#, 5′-TTTCCTGCTTGGCTCTCTCTT-3′; PRC1-shRNA3#, 5′-TTGTTCTTCAGTTGTCTTTCC-3′); and a scrambled negative control shRNA (scr, 5′-GACCTGTACGCCAACACAGTG-3′) were chemically synthesized at Genechem (Shanghai, China). The shRNAs were cloned into the PLKO.1-puro recombinant shRNA expression vector (Invitrogen) and co-transfected with the lentiviral packaging helper plasmids, pCMV-dR8.91 and envelope VSV-G (Addgen, Cambridge, MA, USA) into 293T cells using Lipofectamine 2000 (Invitrogen). The supernatants were collected after transfection and concentrated by ultracentrifugation for 72 h. Infected cells were selected by 4 μg/ml puromycin (Invitrogen) for 2 weeks to generate stable cell line.
To overexpress ZFP36 (ZFP36-OE) or PRC1 (PRC1-OE), full length human ZFP36 or PRC1 cDNA was amplified and cloned into the pCDH-CMV-MCS-Puro expression vector and the pCDHpPACKH1TM Lentivector Packaging Kit (System Biosciences, Mountain View, CA, USA) was used to produce lentivirus particles. Infected cells were selected by 4 μg/ml puromycin for 2 weeks to generate stable cell lines.

To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors. The shRNAs were cloned into the PLKO.1-puro recombinant shRNA expression vector (Invitrogen) and co-transfected with the lentiviral packaging helper plasmids, pCMV-dR8.91 and envelope VSV-G (Addgen, Cambridge, MA, USA) into 293 T cells using Lipofectamine 2000 (Invitrogen). Supernatants were collected 72 h after transfection and concentrated by ultracentrifugation. Infected cells were selected by 4 μg/mL puromycin (Invitrogen) for 2 weeks to generate stable-transfected cell lines.
To overexpress ST3GAL1 (ST3GAL1-OE), full length human ST3GAL1 cDNA was amplified and cloned into the pCDH-CMV-MCS-Puro expression vector and the pCDHpPACKH1TM Lentivector Packaging Kit (System Biosciences, Mountain View, CA, USA) was used to produce lentivirus particles. Infected cells were selected by 4 μg/ml puromycin for 2 weeks to generate stable cell lines.