Dnase 1 amplification grade kit

Total RNA was extracted from IM-treated and untreated cells using TRIzol reagent (Invitrogen). Total RNA was subjected to treatment with a DNAse Amplification Grade I Kit (Invitrogen) for the removal of DNA contamination. Complementary DNA synthesis was performed with Superscript-II Reverse Transcriptase (Invitrogen) following the manufacturer’s protocol. Quantitative Real-Time PCR (RT-qPCR) was performed with SYBR Green Master Mix (Invitrogen) in a Rotor-Gene Q (Qiagen). The following forward (Fow) and reverse (Rev) primers were used: STAT3 - Fow 5’ GGGAGAGAGTTACAGGTTGGACAT 3’, Rev 5’ AGACGCCATTACAAGTGCCA 3’; STATIP1 - Fow 5’ CCACTGTCCCTGCATTGGGATT 3’, Rev 5’ GCCACCTGCTGATACTCAAA 3’; CCND1- Fow 5’ AGAGACCAGGCTGTGTCCCTC 3’, Rev 5’ GTGGTGGCACGTAAGACACAC 3‘; BCL-XL Fow 5’ CTGGGGTCGCATTGTGGC 3’, Rev 5’ AGCCGCCGTTCTCCTGGA 3’; ABCB1 - Fow 5’ CCCATCATTGCAATAGCAGG 3’, Rev 5’ GTTCAAACTTCTGCTCCTGA 3’; ACTB - Fow 5’ ACCTGAGAACTCCACTACCCT 3’, Rev 5’ GGTCCCACCCATGTTCCAG 3’. The PCR cycling conditions included an initial denaturation of 95°C for 10 minutes, followed by 45 cycles of 20 seconds at 95°C, 20 seconds at 60°C, and 40 seconds at 72°C. The β-actin mRNA levels were used as a reference of expression. The fold-expression was calculated according to Schmittgen and Livak [32 (link)]. The primer sequences used in this work are available upon request.

Total RNA was extracted from BC cell lines, tissues from BC patients and healthy control samples using TRIzol reagent (Invitrogen) and a RNeasy mini kit (Qiagen). Total RNA was treated with a DNase Amplification Grade I Kit (Invitrogen) to remove DNA contamination. Complementary DNA synthesis was performed with Superscript-II Reverse Transcriptase (Invitrogen) following the manufacturer’s protocol. RT-qPCR was performed using SYBR Green Master Mix (Invitrogen) in a Rotor-Gene Q (Qiagen). The following forward (Fow) and reverse (Rev) primers were used: MYB - Fow 5’ AGTCTGGAAAGCGTCACTTG 3’, Rev 5’ GTTCCATTCTGTTCCACCAG 3’; EZH2 - Fow 5’ AGAAGGGACCAGTTTGTTGG 3’, Rev 5’ GTGCACAGGCTGTATCCTTC 3’; MITF - Fow 5’ TTGGGCTTGATGGATCCTGC 3’, Rev 5’ GGCAGACCTTGGTTTCCAT 3’; SIP1 - Fow 5’ CCCTTCTGCGACATAAATACGA 3’, Rev 5’ TGTGATTCATGTGCTGCGAGT 3’; and GAPDH - Fow 5’ GTCAACGGATTTGGTCGTATTG -3′, Rev 5’ TGGAAGATGGTGATGGGATTT - 3’. The PCR cycling conditions included an initial denaturation of 95°C for 10 minutes, followed by 45 cycles of 20 seconds at 95°C, 20 seconds at 60°C, and 40 seconds at 72°C. The GAPDH mRNA levels were used as a reference of expression. The fold-expression was calculated according to the ΔΔCT method (17 (link)).

The mRNA levels of cells were investigated by RT-qPCR. Briefly, total RNA was purified using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. Then, 2 μg of RNA was processed using the DNase Amplification Grade I Kit (Invitrogen) to remove DNA contamination and was reverse transcribed into cDNA using the Superscript-III First Strand Synthesis kit (Invitrogen) following the manufacturer’s protocol. RT-qPCR was performed with the SYBR Green Master Mix (Invitrogen) in a Rotor-Gene Q (Qiagen), and the conditions were as follows: 95°C for 10 min, followed by 40 cycles of 30 s at 95°C, 30 s at 60°C and 30 s at 72°C. Each sample was examined in triplicate. The primers used are described in S1 Table. ACTB and GAPDH were used as the reference genes for the mRNA levels. Fold-expression was calculated according to the ΔΔC_t method [36 (link)].