Total RNA was extracted with an RNA Purification Kit (cat #: RC101-01, Vazyme, Nanjing, China) and reverse transcription was performed with a cDNA Reverse Transcription Kit (cat #: R223-01, Vazyme, Nanjing, China). qRT-PCR was performed using SYBR Green qPCR Master Mix ((cat #: Q121-02, Vazyme, Nanjing, China). Relative gene expression was calculated using the 2−ΔΔCT method, and GAPDH was used as a reference for normalization. The qPCR primers were listed in Additional file 2 : Table S1.
Rna purification kit
Manufactured by Vazyme
Sourced in China
The RNA Purification Kit is a laboratory equipment designed to extract and purify RNA from various biological samples. It utilizes a column-based method to efficiently capture and concentrate RNA, while removing contaminants and inhibitors. The kit provides a streamlined workflow for obtaining high-quality RNA suitable for downstream applications, such as RT-PCR, RNA sequencing, and gene expression analysis.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using rna purification kit
1
RNA Extraction and qRT-PCR Analysis
2
Evaluating Epithelial-Mesenchymal Transition in HaCaT Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Prior to qPCR analysis, the HaCaT cells were seeded in a 6-well plate and subjected to graded concentrations of MY-1 (0 nM, 10 nM, and 100 nM) for 24 h. The total RNA was extracted with an RNA purification kit (Vazyme, Nanjing, China) and reverse transcription was performed with a cDNA reverse transcription kit (Vazyme). qPCR was performed employing SYBR Green qPCR Master Mix (Vazyme) and the expression levels of relative genes were calculated utilizing the 2−ΔΔCT method, with GAPDH used as a reference for normalization. The qPCR primers provided by Qingke (Beijing, China) are listed in Table 1 .
Sequences of primers used for the quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR)
| Gene name | Forward primer sequences | Reverse primer sequences |
|---|---|---|
| ACATACACTCTCTTCTCTC | GTCATTCTGATCGGTTAC | |
| ATCATCCTGCTTATCCTT | TTATCTCTTACATCATCTTCTG | |
| AACCTGAGGGAAACTAAT | TTGATAACCTGTCCATCT | |
| CGCTCTTTCCTCGTCAGG | TGGAAGGTAAACTCTGGATTAGA | |
| GGTAGTGGCGATGGCGG | CTGTAGGAACGCCGACTGC |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!