Codon optimized firefly luciferase was cloned into an mRNA production plasmid (optimized 3′ and 5′ UTR and containing a 101 polyA tail), in vitro transcribed in the presence in the presence of N1-methylpseudouridine modified nucleoside (N1mψ), co-transcriptionally capped using the CleanCap™ technology (TriLink) and cellulose purified to remove dsRNA. Purified mRNA was ethanol precipitated, washed, resuspended in nuclease-free water, and subjected to quality control (electrophoresis, dot blot, and transfection into human dendritic cells). mRNA was stored at −80°C until use32 (link).
Cleancap technology
Manufactured by TriLink
Sourced in United States
CleanCap™ technology is a proprietary RNA capping system developed by TriLink. It provides efficient and reliable capping of in vitro transcribed RNA, a critical step in the production of mRNA therapeutics and vaccines.
Automatically generated - may contain errors
Lab products found in correlation
Dlin mc3 dma, by MedChemExpress (1 mentions)
Jetpei, by Polyplus Transfection (1 mentions)
E coli poly a polymerase kit, by New England Biolabs (1 mentions)
Cleancap fluc mrna, by TriLink (1 mentions)
Rneasy rna purification kit, by Qiagen (1 mentions)
Q5 high fidelity polymerase, by New England Biolabs (1 mentions)
Minelute pcr purification kit, by Qiagen (1 mentions)
4 protocols using cleancap technology
1
Firefly Luciferase mRNA Production
2
Formulation and Characterization of Lipid Nanoparticles for mRNA Delivery
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ionizable polyamine-lipid cores, prepared as described above, or DLin-MC3-DMA (MedChem Express, Monmouth Junction, NJ) were combined into an ethanol phase with cholesterol (Sigma-Aldrich), DOPE (Avanti, Alabaster, AL), and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (ammonium salt) (C14-PEG2000, Avanti) at molar ratios of 35:46.5:16:2.5, respectively, in a total volume of 112.5 μl. A separate aqueous phase was prepared consisting of 25 μg of luciferase (TriLink BioTechnologies, San Diego, CA) or EPO (TriLink BioTechnologies) mRNA and 10 mM citrate buffer (pH 3) in a total volume of 337.5 μl. All mRNA was N1-methyl-pseudo-U–capped with CleanCap technology offered by TriLink BioTechnologies. The ethanol and aqueous phases were combined through channels in a microfluidic device using a syringe pump as previously described (39 (link)). NPs were dialyzed against PBS for 2 hours before sterile filtration through syringe filters with 0.2-μm pores and stored at 4°C. JetPEI (Polyplus Transfection, New York, NY)–mRNA complexes were prepared according to manufacturer protocols with N/P = 7. All materials were prepared and handled ribonuclease-free throughout the synthesis, formulation, and characterization steps.
3
Preparation of Fluorescent mRNA Reporters
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cy5-labelled EGFP mRNA, modified with 5-methoxyuridine, capped using CleanCap technology, and polyadenylated were purchased from Trilink Biotechnologies (San Diego, CA, USA). The length of the mRNA was 996 nucleotides, and Cy5-EGFP mRNA contained a 3:1 methoxyuridine ratio with Cy5. NanoLuc mRNA was obtained by in vitro transcription using the T7 HighScribe kit (ThermoFisherScientific, Waltham, MA, USA) according to manufacturer’s specifications, with 200 ng of purified PCR product (F primer: AATTAATACGACTCACTATAGGGATACGCCGCCACCATGAACTCCTTCTCCACAAGC, R primer: GTATCTTATCATGTCTGCTCGAAG, Q5-high fidelity polymerase (NEB, Ipswich, MA, USA), purified with MinElute PCR purification kit (Qiagen Benelux, Venlo, The Netherlands)) as input. NanoLuc mRNA was capped with Vaccinia Capping enzymes (NEB) and extended with a 250 nt poly-A-tail (E. coli polyA polymerase kit, NEB) according to manufacturer’s specifications. Final purification of the mRNA was performed using the RNeasy RNA purification kit (Qiagen) according to manufacturer’s specifications, with elution in RNAse-free MQ. All mRNA was stored at 1 µg/µL in MQ at −80 °C until use. Before use, the mRNA solution was thawed at RT and stored on ice. CleanCap-Fluc mRNA was purchased from TriLink Biotechnologies (San Diego, CA, USA).
4
SARS-CoV-2 Spike mRNA Vaccine Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Codon optimized SARS-CoV-2 di-proline modified spike sequence (S2P), and firefly Luciferase (fLuc) sequence were cloned into an mRNA production plasmid (optimized 3′ and 5’ UTR and containing a 101 polyA tail), in vitro transcribed in the presence of UTP (unmodified) or in the presence of N1-methylpseudouridine modified nucleoside (N1-mψ, modified), co-transcriptionally capped using the CleanCap™ technology (TriLink) and cellulose purified to remove dsRNA [25 (link)]. Purified mRNA was ethanol precipitated, washed, re-suspended in nuclease-free water, and subjected to quality control (electrophoresis, dot blot, endotoxin content and transfection into human DCs). mRNA sequence used in this study is identical to the one used in the Pfizer/BioNTech vaccines except for the 3′ and 5’ UTRs. mRNA was stored at -20 °C until use.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!