Taq universal sybr green supermix
Taq Universal SYBR Green Supermix is a ready-to-use master mix formulated for real-time PCR applications. It contains Taq DNA polymerase, SYBR Green I dye, dNTPs, and optimized buffer components.
Lab products found in correlation
15 protocols using taq universal sybr green supermix
Calcification of Human Aortic Smooth Muscle Cells
Organoid RNA Extraction and qPCR Analysis
Adipose Tissue RNA Extraction and Analysis
For Adm signaling components quantitative Real-time-PCR was performed on VAT RNA (n = 5–6/group) using Taq universal SYBR Green Supermix (Bio-Rad). PCR primers used for amplification were purchased from Integrated DNA Technologies (IDT): Adm (Mm.PT.58.11111908), Crlr (Mm.PT.58.10636953), Ramp2 (Mm.PT.58.30553776), Ramp3 (Mm.PT.58.8586280) as previously described17 (link).
Quantitative Gene Expression Analysis
Cell Lysis and cDNA Synthesis Protocol
Quantitative Real-time PCR Analysis of ADM, CRLR, RAMP2, and RAMP3
Quantification of Tubulin Gene Expression
α-tubulin: forward primer, TCGATATTGAGCGTCCAACCT; reverse primer, CAAAGGCACGTTTGGCATACA;
β-tubulin: forward primer, TGGACTCTGTTCGCTCAGGT; reverse primer, TGCCTCCTTCCGTACCACAT;
GAPDH: forward primer, GGAGCGAGATCCCTCCAAAAT; reverse primer, GGCTGTTGTCATACTTCTCATGG.
Quantifying sRNA Target Gene Expression in Brassica napus
Quantitative Real-time-PCR Analysis of Mitochondrial Genes
Regulation of Vibrio vulnificus Virulence Genes
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!